ID: 1144269806

View in Genome Browser
Species Human (GRCh38)
Location 17:13604708-13604730
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269806_1144269808 3 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data
1144269806_1144269813 26 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269813 17:13604757-13604779 CACCTCTTAGGAAAGGAATCAGG No data
1144269806_1144269814 27 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269814 17:13604758-13604780 ACCTCTTAGGAAAGGAATCAGGG No data
1144269806_1144269809 14 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data
1144269806_1144269811 19 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269811 17:13604750-13604772 TCCAAGGCACCTCTTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269806 Original CRISPR AAAGCTTGCTGCCACTCTCA AGG (reversed) Intergenic