ID: 1144269808

View in Genome Browser
Species Human (GRCh38)
Location 17:13604734-13604756
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269803_1144269808 16 Left 1144269803 17:13604695-13604717 CCATAGAAGAGGCCCTTGAGAGT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data
1144269806_1144269808 3 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data
1144269805_1144269808 4 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269808 Original CRISPR GGTGACACACAGCCTGTCCA AGG Intergenic
No off target data available for this crispr