ID: 1144269809

View in Genome Browser
Species Human (GRCh38)
Location 17:13604745-13604767
Sequence GCCTGTCCAAGGCACCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269803_1144269809 27 Left 1144269803 17:13604695-13604717 CCATAGAAGAGGCCCTTGAGAGT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data
1144269805_1144269809 15 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data
1144269806_1144269809 14 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269809 Original CRISPR GCCTGTCCAAGGCACCTCTT AGG Intergenic