ID: 1144269813

View in Genome Browser
Species Human (GRCh38)
Location 17:13604757-13604779
Sequence CACCTCTTAGGAAAGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269806_1144269813 26 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269813 17:13604757-13604779 CACCTCTTAGGAAAGGAATCAGG No data
1144269805_1144269813 27 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269813 17:13604757-13604779 CACCTCTTAGGAAAGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269813 Original CRISPR CACCTCTTAGGAAAGGAATC AGG Intergenic
No off target data available for this crispr