ID: 1144269814

View in Genome Browser
Species Human (GRCh38)
Location 17:13604758-13604780
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269806_1144269814 27 Left 1144269806 17:13604708-13604730 CCTTGAGAGTGGCAGCAAGCTTT No data
Right 1144269814 17:13604758-13604780 ACCTCTTAGGAAAGGAATCAGGG No data
1144269805_1144269814 28 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269814 17:13604758-13604780 ACCTCTTAGGAAAGGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269814 Original CRISPR ACCTCTTAGGAAAGGAATCA GGG Intergenic