ID: 1144270821

View in Genome Browser
Species Human (GRCh38)
Location 17:13613946-13613968
Sequence CAGCTGTGATCACTATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144270819_1144270821 -2 Left 1144270819 17:13613925-13613947 CCAGGGTCTCTGTAACTGATACA No data
Right 1144270821 17:13613946-13613968 CAGCTGTGATCACTATGGAGTGG No data
1144270818_1144270821 13 Left 1144270818 17:13613910-13613932 CCAGGTCTGGAGAAGCCAGGGTC No data
Right 1144270821 17:13613946-13613968 CAGCTGTGATCACTATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144270821 Original CRISPR CAGCTGTGATCACTATGGAG TGG Intergenic
No off target data available for this crispr