ID: 1144271341

View in Genome Browser
Species Human (GRCh38)
Location 17:13619689-13619711
Sequence GCCACACGAGGGCACACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144271341_1144271354 27 Left 1144271341 17:13619689-13619711 CCCACAGTGTGCCCTCGTGTGGC No data
Right 1144271354 17:13619739-13619761 CTGGTCCTCACGGGCCAAGCTGG No data
1144271341_1144271353 18 Left 1144271341 17:13619689-13619711 CCCACAGTGTGCCCTCGTGTGGC No data
Right 1144271353 17:13619730-13619752 TCAGACATTCTGGTCCTCACGGG No data
1144271341_1144271352 17 Left 1144271341 17:13619689-13619711 CCCACAGTGTGCCCTCGTGTGGC No data
Right 1144271352 17:13619729-13619751 CTCAGACATTCTGGTCCTCACGG No data
1144271341_1144271349 8 Left 1144271341 17:13619689-13619711 CCCACAGTGTGCCCTCGTGTGGC No data
Right 1144271349 17:13619720-13619742 GGAAAAACCCTCAGACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144271341 Original CRISPR GCCACACGAGGGCACACTGT GGG (reversed) Intergenic
No off target data available for this crispr