ID: 1144271531

View in Genome Browser
Species Human (GRCh38)
Location 17:13621941-13621963
Sequence GAGTTCCAGCAGAAGTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144271531_1144271534 14 Left 1144271531 17:13621941-13621963 CCCTAAAACTTCTGCTGGAACTC No data
Right 1144271534 17:13621978-13622000 AAGAAAAATACTCTTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144271531 Original CRISPR GAGTTCCAGCAGAAGTTTTA GGG (reversed) Intergenic
No off target data available for this crispr