ID: 1144282168

View in Genome Browser
Species Human (GRCh38)
Location 17:13736986-13737008
Sequence GAACAGTAAACTGTCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144282168_1144282169 23 Left 1144282168 17:13736986-13737008 CCAGAAAGGACAGTTTACTGTTC No data
Right 1144282169 17:13737032-13737054 ATGTGAATCAGCAGAAGCCTAGG No data
1144282168_1144282170 24 Left 1144282168 17:13736986-13737008 CCAGAAAGGACAGTTTACTGTTC No data
Right 1144282170 17:13737033-13737055 TGTGAATCAGCAGAAGCCTAGGG No data
1144282168_1144282171 25 Left 1144282168 17:13736986-13737008 CCAGAAAGGACAGTTTACTGTTC No data
Right 1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144282168 Original CRISPR GAACAGTAAACTGTCCTTTC TGG (reversed) Intergenic
No off target data available for this crispr