ID: 1144282171

View in Genome Browser
Species Human (GRCh38)
Location 17:13737034-13737056
Sequence GTGAATCAGCAGAAGCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144282168_1144282171 25 Left 1144282168 17:13736986-13737008 CCAGAAAGGACAGTTTACTGTTC No data
Right 1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144282171 Original CRISPR GTGAATCAGCAGAAGCCTAG GGG Intergenic
No off target data available for this crispr