ID: 1144286669

View in Genome Browser
Species Human (GRCh38)
Location 17:13782126-13782148
Sequence ATGATTAGAAGCAGAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144286669_1144286671 27 Left 1144286669 17:13782126-13782148 CCAAAAATTCTGCTTCTAATCAT No data
Right 1144286671 17:13782176-13782198 GATTTAACTATAAGAATGTTTGG No data
1144286669_1144286670 -2 Left 1144286669 17:13782126-13782148 CCAAAAATTCTGCTTCTAATCAT No data
Right 1144286670 17:13782147-13782169 ATTTGTATTTTTAAAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144286669 Original CRISPR ATGATTAGAAGCAGAATTTT TGG (reversed) Intergenic
No off target data available for this crispr