ID: 1144287772

View in Genome Browser
Species Human (GRCh38)
Location 17:13795076-13795098
Sequence CTGCTGTTGTTGGACAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144287772_1144287774 -8 Left 1144287772 17:13795076-13795098 CCAGTTTTGTCCAACAACAGCAG No data
Right 1144287774 17:13795091-13795113 AACAGCAGTTTGCAAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144287772 Original CRISPR CTGCTGTTGTTGGACAAAAC TGG (reversed) Intergenic
No off target data available for this crispr