ID: 1144290808

View in Genome Browser
Species Human (GRCh38)
Location 17:13824470-13824492
Sequence CCAAATCCCCATGTGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144290808_1144290813 -10 Left 1144290808 17:13824470-13824492 CCCTGAACCACATGGGGATTTGG No data
Right 1144290813 17:13824483-13824505 GGGGATTTGGAAGCCAGGTAAGG No data
1144290808_1144290815 13 Left 1144290808 17:13824470-13824492 CCCTGAACCACATGGGGATTTGG No data
Right 1144290815 17:13824506-13824528 CATGCAGATCATAGTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144290808 Original CRISPR CCAAATCCCCATGTGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr