ID: 1144293678

View in Genome Browser
Species Human (GRCh38)
Location 17:13853015-13853037
Sequence CAAATGTCACCTGATCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144293678_1144293680 1 Left 1144293678 17:13853015-13853037 CCTTTCTGATCAGGTGACATTTG No data
Right 1144293680 17:13853039-13853061 GCAGAAACTTGAAGGAAGTGAGG No data
1144293678_1144293679 -7 Left 1144293678 17:13853015-13853037 CCTTTCTGATCAGGTGACATTTG No data
Right 1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG No data
1144293678_1144293681 2 Left 1144293678 17:13853015-13853037 CCTTTCTGATCAGGTGACATTTG No data
Right 1144293681 17:13853040-13853062 CAGAAACTTGAAGGAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144293678 Original CRISPR CAAATGTCACCTGATCAGAA AGG (reversed) Intergenic
No off target data available for this crispr