ID: 1144293679

View in Genome Browser
Species Human (GRCh38)
Location 17:13853031-13853053
Sequence ACATTTGAGCAGAAACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144293678_1144293679 -7 Left 1144293678 17:13853015-13853037 CCTTTCTGATCAGGTGACATTTG No data
Right 1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG No data
1144293674_1144293679 20 Left 1144293674 17:13852988-13853010 CCATTTTAGAAATGAGGTTCAGG No data
Right 1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144293679 Original CRISPR ACATTTGAGCAGAAACTTGA AGG Intergenic
No off target data available for this crispr