ID: 1144297984

View in Genome Browser
Species Human (GRCh38)
Location 17:13897395-13897417
Sequence GTTCTTAAGAAGATAATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144297984_1144297988 2 Left 1144297984 17:13897395-13897417 CCCTTCATTATCTTCTTAAGAAC No data
Right 1144297988 17:13897420-13897442 CCACTAATTGATCAAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144297984 Original CRISPR GTTCTTAAGAAGATAATGAA GGG (reversed) Intergenic
No off target data available for this crispr