ID: 1144302041

View in Genome Browser
Species Human (GRCh38)
Location 17:13930411-13930433
Sequence GACCAACTTGGTATCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144302037_1144302041 7 Left 1144302037 17:13930381-13930403 CCATACTCTGGGGAACATGGCCT No data
Right 1144302041 17:13930411-13930433 GACCAACTTGGTATCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144302041 Original CRISPR GACCAACTTGGTATCCAAAA AGG Intergenic
No off target data available for this crispr