ID: 1144304176

View in Genome Browser
Species Human (GRCh38)
Location 17:13952342-13952364
Sequence GGAATCAATGGCAGTCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144304176_1144304186 8 Left 1144304176 17:13952342-13952364 CCAGCTAGACTGCCATTGATTCC No data
Right 1144304186 17:13952373-13952395 TTTGCCAATATTGACAATGGAGG No data
1144304176_1144304189 25 Left 1144304176 17:13952342-13952364 CCAGCTAGACTGCCATTGATTCC No data
Right 1144304189 17:13952390-13952412 TGGAGGGCAAACAGCATCTCAGG No data
1144304176_1144304187 9 Left 1144304176 17:13952342-13952364 CCAGCTAGACTGCCATTGATTCC No data
Right 1144304187 17:13952374-13952396 TTGCCAATATTGACAATGGAGGG No data
1144304176_1144304184 5 Left 1144304176 17:13952342-13952364 CCAGCTAGACTGCCATTGATTCC No data
Right 1144304184 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144304176 Original CRISPR GGAATCAATGGCAGTCTAGC TGG (reversed) Intergenic
No off target data available for this crispr