ID: 1144304183

View in Genome Browser
Species Human (GRCh38)
Location 17:13952370-13952392
Sequence CCATTGTCAATATTGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144304183_1144304190 20 Left 1144304183 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304183_1144304189 -3 Left 1144304183 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data
Right 1144304189 17:13952390-13952412 TGGAGGGCAAACAGCATCTCAGG No data
1144304183_1144304191 21 Left 1144304183 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data
Right 1144304191 17:13952414-13952436 ATAGATCTGTCCATTTGCCTGGG No data
1144304183_1144304192 26 Left 1144304183 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data
Right 1144304192 17:13952419-13952441 TCTGTCCATTTGCCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144304183 Original CRISPR CCATTGTCAATATTGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr