ID: 1144304188

View in Genome Browser
Species Human (GRCh38)
Location 17:13952377-13952399
Sequence TTGCCCTCCATTGTCAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144304188_1144304191 14 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304191 17:13952414-13952436 ATAGATCTGTCCATTTGCCTGGG No data
1144304188_1144304190 13 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304188_1144304194 28 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304194 17:13952428-13952450 TTGCCTGGGCCTGGAGCCCCAGG No data
1144304188_1144304189 -10 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304189 17:13952390-13952412 TGGAGGGCAAACAGCATCTCAGG No data
1144304188_1144304192 19 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304192 17:13952419-13952441 TCTGTCCATTTGCCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144304188 Original CRISPR TTGCCCTCCATTGTCAATAT TGG (reversed) Intergenic
No off target data available for this crispr