ID: 1144304190

View in Genome Browser
Species Human (GRCh38)
Location 17:13952413-13952435
Sequence AATAGATCTGTCCATTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144304183_1144304190 20 Left 1144304183 17:13952370-13952392 CCCTTTGCCAATATTGACAATGG No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304182_1144304190 23 Left 1144304182 17:13952367-13952389 CCTCCCTTTGCCAATATTGACAA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304188_1144304190 13 Left 1144304188 17:13952377-13952399 CCAATATTGACAATGGAGGGCAA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304181_1144304190 24 Left 1144304181 17:13952366-13952388 CCCTCCCTTTGCCAATATTGACA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304180_1144304190 25 Left 1144304180 17:13952365-13952387 CCCCTCCCTTTGCCAATATTGAC No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304179_1144304190 26 Left 1144304179 17:13952364-13952386 CCCCCTCCCTTTGCCAATATTGA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304178_1144304190 27 Left 1144304178 17:13952363-13952385 CCCCCCTCCCTTTGCCAATATTG No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data
1144304185_1144304190 19 Left 1144304185 17:13952371-13952393 CCTTTGCCAATATTGACAATGGA No data
Right 1144304190 17:13952413-13952435 AATAGATCTGTCCATTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144304190 Original CRISPR AATAGATCTGTCCATTTGCC TGG Intergenic
No off target data available for this crispr