ID: 1144307027

View in Genome Browser
Species Human (GRCh38)
Location 17:13978105-13978127
Sequence ACTGAGGATTTTGATGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307027_1144307031 27 Left 1144307027 17:13978105-13978127 CCTGAAGCATCAAAATCCTCAGT No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data
1144307027_1144307033 29 Left 1144307027 17:13978105-13978127 CCTGAAGCATCAAAATCCTCAGT No data
Right 1144307033 17:13978157-13978179 CACATCTCACCCCCTCAGTGGGG No data
1144307027_1144307034 30 Left 1144307027 17:13978105-13978127 CCTGAAGCATCAAAATCCTCAGT No data
Right 1144307034 17:13978158-13978180 ACATCTCACCCCCTCAGTGGGGG No data
1144307027_1144307032 28 Left 1144307027 17:13978105-13978127 CCTGAAGCATCAAAATCCTCAGT No data
Right 1144307032 17:13978156-13978178 ACACATCTCACCCCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307027 Original CRISPR ACTGAGGATTTTGATGCTTC AGG (reversed) Intergenic
No off target data available for this crispr