ID: 1144307029

View in Genome Browser
Species Human (GRCh38)
Location 17:13978121-13978143
Sequence AAGGCAGAAAAGTTCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307029_1144307034 14 Left 1144307029 17:13978121-13978143 CCTCAGTGGAACTTTTCTGCCTT No data
Right 1144307034 17:13978158-13978180 ACATCTCACCCCCTCAGTGGGGG No data
1144307029_1144307033 13 Left 1144307029 17:13978121-13978143 CCTCAGTGGAACTTTTCTGCCTT No data
Right 1144307033 17:13978157-13978179 CACATCTCACCCCCTCAGTGGGG No data
1144307029_1144307031 11 Left 1144307029 17:13978121-13978143 CCTCAGTGGAACTTTTCTGCCTT No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data
1144307029_1144307032 12 Left 1144307029 17:13978121-13978143 CCTCAGTGGAACTTTTCTGCCTT No data
Right 1144307032 17:13978156-13978178 ACACATCTCACCCCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307029 Original CRISPR AAGGCAGAAAAGTTCCACTG AGG (reversed) Intergenic
No off target data available for this crispr