ID: 1144307030

View in Genome Browser
Species Human (GRCh38)
Location 17:13978140-13978162
Sequence GATGTGTTTTGAGCTAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307030_1144307033 -6 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307033 17:13978157-13978179 CACATCTCACCCCCTCAGTGGGG No data
1144307030_1144307039 12 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307039 17:13978175-13978197 TGGGGGCCCCAGCATAGTCTTGG No data
1144307030_1144307044 24 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307030_1144307031 -8 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data
1144307030_1144307043 20 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307043 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
1144307030_1144307032 -7 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307032 17:13978156-13978178 ACACATCTCACCCCCTCAGTGGG No data
1144307030_1144307034 -5 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307034 17:13978158-13978180 ACATCTCACCCCCTCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307030 Original CRISPR GATGTGTTTTGAGCTAGTCA AGG (reversed) Intergenic
No off target data available for this crispr