ID: 1144307031

View in Genome Browser
Species Human (GRCh38)
Location 17:13978155-13978177
Sequence AACACATCTCACCCCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307029_1144307031 11 Left 1144307029 17:13978121-13978143 CCTCAGTGGAACTTTTCTGCCTT No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data
1144307030_1144307031 -8 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data
1144307027_1144307031 27 Left 1144307027 17:13978105-13978127 CCTGAAGCATCAAAATCCTCAGT No data
Right 1144307031 17:13978155-13978177 AACACATCTCACCCCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307031 Original CRISPR AACACATCTCACCCCCTCAG TGG Intergenic
No off target data available for this crispr