ID: 1144307037

View in Genome Browser
Species Human (GRCh38)
Location 17:13978168-13978190
Sequence TATGCTGGGGCCCCCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307037_1144307046 12 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG No data
1144307037_1144307047 13 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307037_1144307043 -8 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307043 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
1144307037_1144307044 -4 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307037_1144307048 21 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307048 17:13978212-13978234 ACAGAGACTGGAGGGAAGCCAGG No data
1144307037_1144307049 22 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307049 17:13978213-13978235 CAGAGACTGGAGGGAAGCCAGGG No data
1144307037_1144307045 9 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307045 17:13978200-13978222 TTGAGGAAGGTTACAGAGACTGG No data
1144307037_1144307050 23 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307050 17:13978214-13978236 AGAGACTGGAGGGAAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307037 Original CRISPR TATGCTGGGGCCCCCACTGA GGG (reversed) Intergenic
No off target data available for this crispr