ID: 1144307039

View in Genome Browser
Species Human (GRCh38)
Location 17:13978175-13978197
Sequence TGGGGGCCCCAGCATAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307030_1144307039 12 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307039 17:13978175-13978197 TGGGGGCCCCAGCATAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307039 Original CRISPR TGGGGGCCCCAGCATAGTCT TGG Intergenic
No off target data available for this crispr