ID: 1144307040

View in Genome Browser
Species Human (GRCh38)
Location 17:13978181-13978203
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307040_1144307048 8 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307048 17:13978212-13978234 ACAGAGACTGGAGGGAAGCCAGG No data
1144307040_1144307047 0 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307040_1144307046 -1 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG No data
1144307040_1144307050 10 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307050 17:13978214-13978236 AGAGACTGGAGGGAAGCCAGGGG No data
1144307040_1144307049 9 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307049 17:13978213-13978235 CAGAGACTGGAGGGAAGCCAGGG No data
1144307040_1144307045 -4 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307045 17:13978200-13978222 TTGAGGAAGGTTACAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307040 Original CRISPR TCAATACCAAGACTATGCTG GGG (reversed) Intergenic