ID: 1144307041

View in Genome Browser
Species Human (GRCh38)
Location 17:13978182-13978204
Sequence CTCAATACCAAGACTATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307041_1144307045 -5 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307045 17:13978200-13978222 TTGAGGAAGGTTACAGAGACTGG No data
1144307041_1144307047 -1 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307041_1144307049 8 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307049 17:13978213-13978235 CAGAGACTGGAGGGAAGCCAGGG No data
1144307041_1144307046 -2 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG No data
1144307041_1144307048 7 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307048 17:13978212-13978234 ACAGAGACTGGAGGGAAGCCAGG No data
1144307041_1144307050 9 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307050 17:13978214-13978236 AGAGACTGGAGGGAAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307041 Original CRISPR CTCAATACCAAGACTATGCT GGG (reversed) Intergenic