ID: 1144307042

View in Genome Browser
Species Human (GRCh38)
Location 17:13978183-13978205
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307042_1144307045 -6 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307045 17:13978200-13978222 TTGAGGAAGGTTACAGAGACTGG No data
1144307042_1144307046 -3 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG No data
1144307042_1144307049 7 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307049 17:13978213-13978235 CAGAGACTGGAGGGAAGCCAGGG No data
1144307042_1144307050 8 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307050 17:13978214-13978236 AGAGACTGGAGGGAAGCCAGGGG No data
1144307042_1144307048 6 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307048 17:13978212-13978234 ACAGAGACTGGAGGGAAGCCAGG No data
1144307042_1144307047 -2 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307042 Original CRISPR CCTCAATACCAAGACTATGC TGG (reversed) Intergenic