ID: 1144307044

View in Genome Browser
Species Human (GRCh38)
Location 17:13978187-13978209
Sequence CATAGTCTTGGTATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307038_1144307044 -5 Left 1144307038 17:13978169-13978191 CCTCAGTGGGGGCCCCAGCATAG No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307030_1144307044 24 Left 1144307030 17:13978140-13978162 CCTTGACTAGCTCAAAACACATC No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307035_1144307044 -2 Left 1144307035 17:13978166-13978188 CCCCCTCAGTGGGGGCCCCAGCA No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307036_1144307044 -3 Left 1144307036 17:13978167-13978189 CCCCTCAGTGGGGGCCCCAGCAT No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data
1144307037_1144307044 -4 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307044 17:13978187-13978209 CATAGTCTTGGTATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307044 Original CRISPR CATAGTCTTGGTATTGAGGA AGG Intergenic
No off target data available for this crispr