ID: 1144307047

View in Genome Browser
Species Human (GRCh38)
Location 17:13978204-13978226
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144307041_1144307047 -1 Left 1144307041 17:13978182-13978204 CCCAGCATAGTCTTGGTATTGAG No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307036_1144307047 14 Left 1144307036 17:13978167-13978189 CCCCTCAGTGGGGGCCCCAGCAT No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307040_1144307047 0 Left 1144307040 17:13978181-13978203 CCCCAGCATAGTCTTGGTATTGA No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307037_1144307047 13 Left 1144307037 17:13978168-13978190 CCCTCAGTGGGGGCCCCAGCATA No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307038_1144307047 12 Left 1144307038 17:13978169-13978191 CCTCAGTGGGGGCCCCAGCATAG No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307035_1144307047 15 Left 1144307035 17:13978166-13978188 CCCCCTCAGTGGGGGCCCCAGCA No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data
1144307042_1144307047 -2 Left 1144307042 17:13978183-13978205 CCAGCATAGTCTTGGTATTGAGG No data
Right 1144307047 17:13978204-13978226 GGAAGGTTACAGAGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144307047 Original CRISPR GGAAGGTTACAGAGACTGGA GGG Intergenic