ID: 1144308935

View in Genome Browser
Species Human (GRCh38)
Location 17:13994590-13994612
Sequence CAGTGTTCCAAGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144308929_1144308935 -2 Left 1144308929 17:13994569-13994591 CCTCCATTTGCTTCCCTTTTCCA No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308930_1144308935 -5 Left 1144308930 17:13994572-13994594 CCATTTGCTTCCCTTTTCCAGTG No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308923_1144308935 28 Left 1144308923 17:13994539-13994561 CCATCCTAGGAGGCTTGTCTCTA No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308925_1144308935 5 Left 1144308925 17:13994562-13994584 CCAACCCCCTCCATTTGCTTCCC No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308924_1144308935 24 Left 1144308924 17:13994543-13994565 CCTAGGAGGCTTGTCTCTACCAA No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308922_1144308935 29 Left 1144308922 17:13994538-13994560 CCCATCCTAGGAGGCTTGTCTCT No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308927_1144308935 0 Left 1144308927 17:13994567-13994589 CCCCTCCATTTGCTTCCCTTTTC No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308926_1144308935 1 Left 1144308926 17:13994566-13994588 CCCCCTCCATTTGCTTCCCTTTT No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data
1144308928_1144308935 -1 Left 1144308928 17:13994568-13994590 CCCTCCATTTGCTTCCCTTTTCC No data
Right 1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144308935 Original CRISPR CAGTGTTCCAAGAGGAAAGA AGG Intergenic
No off target data available for this crispr