ID: 1144310684

View in Genome Browser
Species Human (GRCh38)
Location 17:14011467-14011489
Sequence ATTCATCCCCTGCCAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144310679_1144310684 -4 Left 1144310679 17:14011448-14011470 CCCCTTCAGAAGCCAGTAAATTC No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310680_1144310684 -5 Left 1144310680 17:14011449-14011471 CCCTTCAGAAGCCAGTAAATTCA No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310674_1144310684 24 Left 1144310674 17:14011420-14011442 CCCTTCCCTATCACATTCAAACA No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310678_1144310684 -3 Left 1144310678 17:14011447-14011469 CCCCCTTCAGAAGCCAGTAAATT No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310681_1144310684 -6 Left 1144310681 17:14011450-14011472 CCTTCAGAAGCCAGTAAATTCAT No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310677_1144310684 18 Left 1144310677 17:14011426-14011448 CCTATCACATTCAAACACACACC No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310675_1144310684 23 Left 1144310675 17:14011421-14011443 CCTTCCCTATCACATTCAAACAC No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data
1144310676_1144310684 19 Left 1144310676 17:14011425-14011447 CCCTATCACATTCAAACACACAC No data
Right 1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144310684 Original CRISPR ATTCATCCCCTGCCAAGGAA TGG Intergenic
No off target data available for this crispr