ID: 1144328801

View in Genome Browser
Species Human (GRCh38)
Location 17:14206423-14206445
Sequence AGCAAAGAAGCCCCTACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144328801_1144328810 11 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328810 17:14206457-14206479 GGGGAGGTGTGAGGAGCATCAGG 0: 1
1: 1
2: 3
3: 45
4: 506
1144328801_1144328803 -9 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328803 17:14206437-14206459 TTCTTTGCTCCCCACAATGTGGG 0: 1
1: 0
2: 0
3: 13
4: 218
1144328801_1144328805 -5 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328805 17:14206441-14206463 TTGCTCCCCACAATGTGGGGAGG 0: 1
1: 0
2: 2
3: 27
4: 274
1144328801_1144328812 15 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328812 17:14206461-14206483 AGGTGTGAGGAGCATCAGGTGGG 0: 1
1: 0
2: 1
3: 36
4: 373
1144328801_1144328813 19 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328813 17:14206465-14206487 GTGAGGAGCATCAGGTGGGCAGG 0: 1
1: 0
2: 4
3: 20
4: 299
1144328801_1144328804 -8 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328804 17:14206438-14206460 TCTTTGCTCCCCACAATGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 302
1144328801_1144328802 -10 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328802 17:14206436-14206458 CTTCTTTGCTCCCCACAATGTGG 0: 1
1: 0
2: 0
3: 19
4: 225
1144328801_1144328809 2 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328809 17:14206448-14206470 CCACAATGTGGGGAGGTGTGAGG 0: 1
1: 0
2: 0
3: 25
4: 281
1144328801_1144328811 14 Left 1144328801 17:14206423-14206445 CCGTGTGTAGGGGCTTCTTTGCT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1144328811 17:14206460-14206482 GAGGTGTGAGGAGCATCAGGTGG 0: 1
1: 0
2: 3
3: 38
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144328801 Original CRISPR AGCAAAGAAGCCCCTACACA CGG (reversed) Intronic
900489170 1:2937898-2937920 TGCACATAAGCCCCCACACATGG + Intergenic
902763985 1:18602868-18602890 GGCAAAGCAGTCCCTACAAATGG + Intergenic
910010719 1:82458285-82458307 AGCAAAGAAGCAGCTTCAAATGG + Intergenic
913032404 1:114922473-114922495 AGCAAAGGAGGCACTTCACATGG + Intronic
920134120 1:203755703-203755725 GGCAAAGGAGACCCAACACAGGG + Intergenic
920758510 1:208758873-208758895 AGGAAATAAACCCATACACAGGG + Intergenic
920806072 1:209234941-209234963 AGCAAAAAAGCTTCTGCACAGGG + Intergenic
922984791 1:229857907-229857929 AGCAGAGAAAACCCTTCACATGG + Intergenic
1066005967 10:31146497-31146519 AGCGAAGAAGCCCAGACTCAGGG + Intergenic
1066640931 10:37553451-37553473 AGCAGAGCAGCCCCTAGCCAAGG + Intergenic
1067218780 10:44326373-44326395 AGCAAGGAATCCCATAAACAAGG + Intergenic
1067373769 10:45708966-45708988 AGGAAAGAAGCCTAGACACATGG - Intergenic
1067379915 10:45763269-45763291 AGGAAAGAAGCCTAGACACATGG + Intronic
1067534763 10:47100980-47101002 AGCAAAAAAGCCCAGACTCAGGG - Intergenic
1067881598 10:50050730-50050752 AGGAAAGAAGCCTAGACACATGG - Intergenic
1067887614 10:50103923-50103945 AGGAAAGAAGCCTAGACACATGG + Intronic
1072661276 10:97364960-97364982 AGCAGAGAAGACACTAGACACGG + Intronic
1074254319 10:111785057-111785079 AGCAAAGGAGGCTCTCCACAAGG + Intergenic
1074710685 10:116175065-116175087 AAGAAAGAAGCCGCAACACACGG - Intronic
1075769799 10:124923688-124923710 AGAAAAAAAGCACCTTCACAAGG + Intergenic
1076350057 10:129809562-129809584 CACAAAGCAGCCCCTCCACAGGG + Intergenic
1078089814 11:8258055-8258077 AGCAAAGCAACCTCTACACTGGG + Intronic
1078361746 11:10674678-10674700 AGCAGAGAAGCCACAAGACAGGG - Intronic
1079910028 11:26298409-26298431 ACAACAGAAGTCCCTACACATGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1084229947 11:67744334-67744356 AGCAATAGAGCCCCTACAGAGGG - Intergenic
1086382719 11:86274583-86274605 AGTAATGAAGCACCAACACAAGG - Intronic
1089625633 11:119749063-119749085 AGCAGAGGAGCCCCTCCACTCGG - Intergenic
1094761183 12:33534845-33534867 AGCAAAGAATACTTTACACAAGG - Intergenic
1095296088 12:40529360-40529382 AGCAAAGAATCCCTTTCACGTGG + Intronic
1097895411 12:64820246-64820268 AGAAAAGAAAGCCCAACACAAGG - Intronic
1098135333 12:67396035-67396057 AGCAAAGAAGCCCCACCAGAAGG - Intergenic
1098227046 12:68335054-68335076 AGGAAAACAGACCCTACACAAGG + Intergenic
1098719711 12:73881399-73881421 AGCAAAGCAGCACCTTCACAAGG + Intergenic
1100801399 12:98235135-98235157 AGAAATGGAGCCCCCACACAAGG - Intergenic
1101825203 12:108215025-108215047 AGCAAAGAAGGAACTAGACATGG - Intronic
1103339961 12:120215979-120216001 AGGAAAGAAGCCACTCCAGAAGG - Intronic
1104732156 12:131113344-131113366 AGCAAAGAAGCCACATCACTGGG - Intronic
1107064920 13:36202897-36202919 GGCAAAGAAGCAACTCCACAGGG + Intronic
1107983183 13:45752878-45752900 AGCAAAGCACCTCCTTCACAAGG + Intergenic
1109956804 13:69579822-69579844 AGAAAAGAAGCCCATACAATAGG + Intergenic
1110315280 13:74099616-74099638 AGCAAAGATGCTCCTAGGCATGG + Intronic
1116187971 14:41623295-41623317 AGCAAAGCAGCCGCTTCACAAGG - Intronic
1118636910 14:67756336-67756358 TACAGAGAAGCCCCTAGACAGGG + Intronic
1119704286 14:76774321-76774343 AGCAAAGAACCCCATAAACAGGG - Intronic
1122730492 14:103793441-103793463 AGCAAGGCAGCTCCTCCACAAGG - Intronic
1126738647 15:51756080-51756102 AGAAAAGAAGGCCAAACACAGGG + Intronic
1129717133 15:77859117-77859139 AGCAAAGAACCCTCTTCACAAGG + Intergenic
1130440268 15:83945952-83945974 ATCAAAGAAGTCACTACCCAGGG - Intronic
1133169734 16:3974746-3974768 AGCAAAGAAGGCATTCCACAAGG + Intronic
1134233354 16:12446621-12446643 TGCAAGGAATCCCCTCCACAGGG - Intronic
1136316255 16:29456031-29456053 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1138780649 16:59781008-59781030 AGCAAAGATGCCCCTTGAAAAGG + Intergenic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1144418393 17:15072914-15072936 AGAAATGAAGACCCAACACATGG - Intergenic
1151988129 17:77557103-77557125 AAGAAAGAAGCCCCTACCCCTGG - Intergenic
1155540912 18:26867438-26867460 CACAAGGAAGCCCCTAAACATGG - Intergenic
1156963552 18:43062129-43062151 AGCAAAAAAGCCGCAACATAGGG + Intronic
1157368886 18:47091941-47091963 AGAAAATAAGCCCCTAGAAATGG - Intronic
1157576303 18:48746146-48746168 AGCAAAGATGGCCCCACAGATGG - Intronic
1157718441 18:49905442-49905464 AGCAAACAAGACCCTTCAGAAGG - Intronic
1158093552 18:53744275-53744297 AGCAAAGCACCTCCTTCACAAGG + Intergenic
1158191245 18:54831319-54831341 AGCAAAGAAGCCCATGAACCTGG + Intronic
1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160131997 18:76233768-76233790 TGCAAAGAAGCCCCTAAATCAGG + Intergenic
1162513414 19:11133601-11133623 AGGCAATAACCCCCTACACAGGG - Intronic
926578789 2:14612178-14612200 AGCAATGTAGCACCTACATAAGG - Intergenic
932689691 2:73901633-73901655 AGAAAAGAACTCCCTACACCTGG - Intronic
934494125 2:94782702-94782724 AGGATTGAAGCCCCCACACAGGG - Intergenic
938764430 2:134450921-134450943 AGCCAAGAGGCCCATTCACAAGG - Exonic
938971822 2:136439715-136439737 AGCAGAGATGCCCTTACTCAAGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
941770263 2:169337378-169337400 AGCAAAGATGGCCTTATACATGG - Intronic
945178192 2:207064714-207064736 AGCCAAGATGCCCCTTAACAGGG - Intergenic
947009084 2:225546436-225546458 AGCAGAGGAGCCTCTCCACATGG + Intronic
1172012345 20:31852911-31852933 AACAAAGAGGCCCCTCCACCTGG - Intronic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1176887311 21:14272297-14272319 AGTAAAGAAGTCCCTACCTAAGG - Intergenic
1178728635 21:35078693-35078715 AGGAAAGAAGGCCCTGCCCAAGG - Intronic
1178777531 21:35566321-35566343 AGCAAAGAAGCCCCAGTACAAGG - Intronic
1179445722 21:41428900-41428922 CGGAAGGAAGCCCCTGCACAGGG + Intronic
1180187670 21:46147553-46147575 AGCAAAGCAGCCTCACCACAAGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
949373676 3:3363451-3363473 AGGACAGAGGCCCTTACACATGG - Intergenic
950350842 3:12350498-12350520 TTCAAAGACGCCCCCACACAGGG - Intronic
951295581 3:20930241-20930263 GGCAAAGTACCCCCTTCACATGG + Intergenic
954734643 3:52696255-52696277 CGCAAAGAAGGCCATATACATGG - Exonic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
955877318 3:63505875-63505897 GGCAAAGAAGGCCCTTCATAAGG - Intronic
956711996 3:72047299-72047321 GGGAAAAAAGCCCCTACTCATGG + Intergenic
957125226 3:76151015-76151037 AGCTAAGAGGACCCAACACACGG - Intronic
965402669 3:168231623-168231645 GGCCAGGAAGCCCCTAAACATGG - Intergenic
969890063 4:10251811-10251833 AGCAAAGAACCACCTTCACCTGG + Intergenic
973175441 4:47199453-47199475 AGACAAGAGGCTCCTACACAGGG - Intronic
974974923 4:68880028-68880050 AACAAAGAAGGCCCACCACAGGG + Intergenic
975802247 4:78072993-78073015 AGGAAAGAAGCCCTTACAGAAGG + Intronic
976337228 4:83903917-83903939 AGTTAAGAAGACCCAACACACGG - Intergenic
978586227 4:110278630-110278652 AGCAAAAAAGACATTACACAGGG + Intergenic
980437788 4:132801610-132801632 AGTAAAGTAGGACCTACACATGG - Intergenic
986401453 5:7385684-7385706 AGCAAGGAACCTCCTTCACAAGG + Intergenic
988962974 5:36387880-36387902 ACCAAGGAACCCCCTACATAAGG - Intergenic
1010165529 6:72910957-72910979 AGCAAAGAAGCTCACACACAGGG + Intronic
1010253366 6:73731396-73731418 AGAAAATAAGCCCATACAGAGGG + Intronic
1011746227 6:90410339-90410361 GGCAAAGAAGCCCATCCAGAAGG - Intergenic
1013318315 6:108962306-108962328 AGCACAGAAGGCCATTCACAAGG - Intronic
1013409037 6:109868141-109868163 AGCAAATAAACCACTAAACAGGG - Intergenic
1015083799 6:129263196-129263218 GACAAACAAGACCCTACACAGGG + Intronic
1015118960 6:129680596-129680618 AGCAAGCAGCCCCCTACACAGGG + Intronic
1015613259 6:135048520-135048542 AGCAAAGAACCCTCTCCTCAAGG + Intronic
1017864372 6:158430265-158430287 AACAAAGAAGCCCATCCACATGG + Intronic
1019538544 7:1541172-1541194 AGCGCAGAAGCCCCTGCCCACGG + Exonic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019727169 7:2609441-2609463 AGCAGAAACGCTCCTACACACGG + Intronic
1020118873 7:5491819-5491841 TGCAAAGAGGACCCCACACATGG + Intronic
1020645777 7:10812374-10812396 AGCCAAGAAGCCACTACTCCCGG + Intergenic
1024482120 7:49874730-49874752 AGCAAAGGTGCCCCAACTCAAGG - Intronic
1026896665 7:74013518-74013540 GGAACAGAAGCCCCTCCACAGGG + Intergenic
1031452704 7:121941443-121941465 GGCTAAGAAGACCATACACAAGG - Intronic
1031951922 7:127901496-127901518 AGTGAAGAAGCCTCTGCACAGGG + Intronic
1033545753 7:142398801-142398823 AGCAAAGAAGCCAATCCTCATGG - Intergenic
1033604665 7:142917841-142917863 AGCAAACAAAACCCTACAGAAGG - Intronic
1034575890 7:151997080-151997102 AGAAAATAAGCTTCTACACAGGG + Intronic
1035785487 8:2256700-2256722 AGCCTAGAAGCTCCTCCACATGG - Intergenic
1035807321 8:2465016-2465038 AGCCTAGAAGCTCCTCCACATGG + Intergenic
1042393601 8:68264845-68264867 AAAAAAGAAGCCACTCCACAGGG - Intergenic
1044185035 8:89240542-89240564 AGCAAAGAAGCACCTGCTCAGGG + Intergenic
1048165787 8:132060102-132060124 AGGAAAGAAAACCCTTCACAAGG - Intronic
1048732632 8:137460858-137460880 AGAAAATAAGACCCTAAACAAGG + Intergenic
1050024509 9:1320011-1320033 AGCAAAGAAGCCCCTTCAGCAGG - Intergenic
1050449197 9:5761987-5762009 AGGAAAGAAGCCACTACTTATGG - Intronic
1056272672 9:84961977-84961999 AGCAAAGAAGACCCCACTCCTGG - Intronic
1056307419 9:85303654-85303676 AGAAAAAAAACCCCTACACTTGG - Intergenic
1056681120 9:88720110-88720132 AGCTAATAAGCACCTAAACAAGG - Intergenic
1186439764 X:9575522-9575544 AGGAACGAAGCACCGACACAGGG - Intronic
1196633381 X:117970062-117970084 AGCAAAGCAGCACATACACTGGG + Intronic
1200024670 X:153247262-153247284 AGGAAAGTAGCCCCTTCACATGG - Intergenic