ID: 1144329682

View in Genome Browser
Species Human (GRCh38)
Location 17:14212516-14212538
Sequence GAGAGTGTCACAGGCGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144329682_1144329693 19 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329693 17:14212558-14212580 GGGGCTGCCTTTGTGCAGCCTGG No data
1144329682_1144329698 26 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329698 17:14212565-14212587 CCTTTGTGCAGCCTGGCTGGGGG No data
1144329682_1144329687 -1 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329687 17:14212538-14212560 CAGGACCCGCCACCTGACTCGGG No data
1144329682_1144329688 0 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329688 17:14212539-14212561 AGGACCCGCCACCTGACTCGGGG No data
1144329682_1144329696 25 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329696 17:14212564-14212586 GCCTTTGTGCAGCCTGGCTGGGG No data
1144329682_1144329694 23 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329694 17:14212562-14212584 CTGCCTTTGTGCAGCCTGGCTGG No data
1144329682_1144329686 -2 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329686 17:14212537-14212559 TCAGGACCCGCCACCTGACTCGG No data
1144329682_1144329695 24 Left 1144329682 17:14212516-14212538 CCAACCTCGCCTGTGACACTCTC No data
Right 1144329695 17:14212563-14212585 TGCCTTTGTGCAGCCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144329682 Original CRISPR GAGAGTGTCACAGGCGAGGT TGG (reversed) Intergenic
No off target data available for this crispr