ID: 1144331549

View in Genome Browser
Species Human (GRCh38)
Location 17:14228705-14228727
Sequence TAGCCCGGGACCCCAGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144331549_1144331557 16 Left 1144331549 17:14228705-14228727 CCCCCCGCTGGGGTCCCGGGCTA No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144331549 Original CRISPR TAGCCCGGGACCCCAGCGGG GGG (reversed) Intergenic
No off target data available for this crispr