ID: 1144331552 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:14228708-14228730 |
Sequence | TGATAGCCCGGGACCCCAGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144331552_1144331557 | 13 | Left | 1144331552 | 17:14228708-14228730 | CCCGCTGGGGTCCCGGGCTATCA | No data | ||
Right | 1144331557 | 17:14228744-14228766 | ATACAAGTCCATAAGCCACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144331552 | Original CRISPR | TGATAGCCCGGGACCCCAGC GGG (reversed) | Intergenic | ||