ID: 1144331553

View in Genome Browser
Species Human (GRCh38)
Location 17:14228709-14228731
Sequence ATGATAGCCCGGGACCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144331553_1144331557 12 Left 1144331553 17:14228709-14228731 CCGCTGGGGTCCCGGGCTATCAT No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144331553 Original CRISPR ATGATAGCCCGGGACCCCAG CGG (reversed) Intergenic