ID: 1144331557

View in Genome Browser
Species Human (GRCh38)
Location 17:14228744-14228766
Sequence ATACAAGTCCATAAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144331549_1144331557 16 Left 1144331549 17:14228705-14228727 CCCCCCGCTGGGGTCCCGGGCTA No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331554_1144331557 2 Left 1144331554 17:14228719-14228741 CCCGGGCTATCATCTAATAAAAG No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331551_1144331557 14 Left 1144331551 17:14228707-14228729 CCCCGCTGGGGTCCCGGGCTATC No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331552_1144331557 13 Left 1144331552 17:14228708-14228730 CCCGCTGGGGTCCCGGGCTATCA No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331550_1144331557 15 Left 1144331550 17:14228706-14228728 CCCCCGCTGGGGTCCCGGGCTAT No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331555_1144331557 1 Left 1144331555 17:14228720-14228742 CCGGGCTATCATCTAATAAAAGC No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331546_1144331557 25 Left 1144331546 17:14228696-14228718 CCTGGGCATCCCCCCGCTGGGGT No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data
1144331553_1144331557 12 Left 1144331553 17:14228709-14228731 CCGCTGGGGTCCCGGGCTATCAT No data
Right 1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144331557 Original CRISPR ATACAAGTCCATAAGCCACA TGG Intergenic