ID: 1144333628

View in Genome Browser
Species Human (GRCh38)
Location 17:14248764-14248786
Sequence GTAACCAAGAAGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144333628_1144333633 -10 Left 1144333628 17:14248764-14248786 CCTCCCACCTTCTTCTTGGTTAC No data
Right 1144333633 17:14248777-14248799 TCTTGGTTACTAGTTATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144333628 Original CRISPR GTAACCAAGAAGAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr