ID: 1144334684

View in Genome Browser
Species Human (GRCh38)
Location 17:14258095-14258117
Sequence TTGTGTGAAGAAAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144334684_1144334689 -7 Left 1144334684 17:14258095-14258117 CCACCTTCCTTTTCTTCACACAA No data
Right 1144334689 17:14258111-14258133 CACACAAACTGGGTGCACTTTGG No data
1144334684_1144334692 16 Left 1144334684 17:14258095-14258117 CCACCTTCCTTTTCTTCACACAA No data
Right 1144334692 17:14258134-14258156 CCTGGACCTGTTCCTCTAACTGG No data
1144334684_1144334690 -2 Left 1144334684 17:14258095-14258117 CCACCTTCCTTTTCTTCACACAA No data
Right 1144334690 17:14258116-14258138 AAACTGGGTGCACTTTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144334684 Original CRISPR TTGTGTGAAGAAAAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr