ID: 1144335389

View in Genome Browser
Species Human (GRCh38)
Location 17:14264570-14264592
Sequence TTGGAGAAGTATAAAAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144335389_1144335397 29 Left 1144335389 17:14264570-14264592 CCTACCTTTTTATACTTCTCCAA No data
Right 1144335397 17:14264622-14264644 CTTTGACACTTCACTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144335389 Original CRISPR TTGGAGAAGTATAAAAAGGT AGG (reversed) Intergenic
No off target data available for this crispr