ID: 1144335699

View in Genome Browser
Species Human (GRCh38)
Location 17:14267302-14267324
Sequence CCTTATATGAGAAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144335699_1144335711 30 Left 1144335699 17:14267302-14267324 CCCTCTACCTTTCTCATATAAGG No data
Right 1144335711 17:14267355-14267377 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
1144335699_1144335704 -6 Left 1144335699 17:14267302-14267324 CCCTCTACCTTTCTCATATAAGG No data
Right 1144335704 17:14267319-14267341 ATAAGGACATATATCCGGCCAGG No data
1144335699_1144335710 29 Left 1144335699 17:14267302-14267324 CCCTCTACCTTTCTCATATAAGG No data
Right 1144335710 17:14267354-14267376 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
1144335699_1144335705 2 Left 1144335699 17:14267302-14267324 CCCTCTACCTTTCTCATATAAGG No data
Right 1144335705 17:14267327-14267349 ATATATCCGGCCAGGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144335699 Original CRISPR CCTTATATGAGAAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr