ID: 1144339741

View in Genome Browser
Species Human (GRCh38)
Location 17:14301673-14301695
Sequence CGGCGCGGCGGCGCAGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 370}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144339741_1144339749 -6 Left 1144339741 17:14301673-14301695 CCGGCTCCTGCGCCGCCGCGCCG 0: 1
1: 1
2: 3
3: 33
4: 370
Right 1144339749 17:14301690-14301712 GCGCCGGGGCTGCTGCTCCTGGG 0: 1
1: 0
2: 0
3: 33
4: 318
1144339741_1144339751 0 Left 1144339741 17:14301673-14301695 CCGGCTCCTGCGCCGCCGCGCCG 0: 1
1: 1
2: 3
3: 33
4: 370
Right 1144339751 17:14301696-14301718 GGGCTGCTGCTCCTGGGCTCTGG 0: 1
1: 1
2: 6
3: 77
4: 798
1144339741_1144339752 1 Left 1144339741 17:14301673-14301695 CCGGCTCCTGCGCCGCCGCGCCG 0: 1
1: 1
2: 3
3: 33
4: 370
Right 1144339752 17:14301697-14301719 GGCTGCTGCTCCTGGGCTCTGGG 0: 1
1: 1
2: 6
3: 69
4: 548
1144339741_1144339748 -7 Left 1144339741 17:14301673-14301695 CCGGCTCCTGCGCCGCCGCGCCG 0: 1
1: 1
2: 3
3: 33
4: 370
Right 1144339748 17:14301689-14301711 CGCGCCGGGGCTGCTGCTCCTGG 0: 1
1: 0
2: 4
3: 34
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144339741 Original CRISPR CGGCGCGGCGGCGCAGGAGC CGG (reversed) Exonic
900092219 1:925440-925462 CGACGCGGGGGCGCCTGAGCCGG + Intronic
900119196 1:1041333-1041355 CGCAGGCGCGGCGCAGGAGCTGG - Exonic
900149525 1:1171965-1171987 CGGGGAGGCGGCTCCGGAGCGGG + Intergenic
900269176 1:1778426-1778448 CTGCTCGGCGGCGCCGGCGCCGG - Intronic
900512673 1:3068013-3068035 AGGCGCTGCGGCGGAGGGGCCGG - Intergenic
901199169 1:7457044-7457066 GGGCACGGCGGCGCAGGGGGCGG - Intronic
901556128 1:10032816-10032838 CGGCGCGGCTGCGCGGGACGGGG + Intronic
902044276 1:13513558-13513580 CGCCGCGGCGGCGCAGGCTGGGG + Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
903466420 1:23555060-23555082 CGGCGCTGCGGCGCCCGGGCTGG - Intergenic
903738177 1:25543576-25543598 CGCCGCGGCGGAGCTGGCGCTGG + Exonic
903777114 1:25800265-25800287 CTGCGCGGCGGGGCCGGGGCTGG - Exonic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
904467762 1:30718426-30718448 CGGCGGGGCGGGGCCAGAGCAGG - Intronic
905107778 1:35574310-35574332 CGGCCAGGCCGTGCAGGAGCCGG - Exonic
905463079 1:38134022-38134044 CGGGGCGGCGGAGCAGGCGGAGG + Intergenic
905648299 1:39639746-39639768 CGGAGCTGCGGCGCAGGAAAGGG - Exonic
906641576 1:47444064-47444086 CGCTGCGGCGGCGCTGGAGGAGG - Intergenic
907440401 1:54475016-54475038 CTGGGAGGCGGCGGAGGAGCCGG - Intergenic
907920017 1:58903667-58903689 CGGCGGGGCGGGGCAGGGCCGGG + Intergenic
908501217 1:64745223-64745245 CAGCGCGGCGGGGCTGGGGCCGG + Exonic
909170016 1:72282883-72282905 AGGCGCGGCGGCGGGGGAGGAGG + Intergenic
911527544 1:99004758-99004780 GGGCGCGGCGGCGGAGGCGGCGG + Exonic
912619517 1:111140562-111140584 CGGAGCGCCGGCGCGGGAGCCGG + Intronic
914702932 1:150150341-150150363 CGCCGCGGCGCCGACGGAGCGGG - Intronic
914720121 1:150282563-150282585 CGGAGAGACGGCGAAGGAGCTGG + Intronic
914760327 1:150593402-150593424 GGGGGCGGGGGTGCAGGAGCTGG + Intergenic
916233341 1:162561647-162561669 CGGCGGGGCGGGCCGGGAGCGGG - Exonic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
916666992 1:166975583-166975605 CGGGGCGGAGGCGCGGGAGGCGG - Intronic
917310129 1:173669876-173669898 CGGAACCGCGGCGCAGGAGGAGG - Intergenic
919103531 1:193122090-193122112 CGTCGCGGCGGCGAAGGAGGAGG + Exonic
919419724 1:197355428-197355450 CGGCGCCGCGGAGCAGGGGGTGG + Intronic
922809219 1:228406646-228406668 GGGTGCGGCGGCGCAGGCTCGGG + Exonic
924052374 1:240092079-240092101 CGGCGCGGCGGCGCAGCAGCGGG + Exonic
924482787 1:244451932-244451954 CGGCCCGGCGGGGCGGGGGCGGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1064209102 10:13348177-13348199 CGGCGCGGCCCTGCGGGAGCCGG + Exonic
1065177741 10:23095582-23095604 GGGCGGAGCGGCGCCGGAGCGGG + Exonic
1066406941 10:35127233-35127255 GGGCGACGCGGCGCAGGAGGTGG + Intronic
1067980019 10:51074259-51074281 AGGCGCGGTGGCGGGGGAGCGGG - Exonic
1068538640 10:58267945-58267967 GGGGGCGGGGGCGCAGGAGGTGG - Intergenic
1068554910 10:58448298-58448320 CGGCGCTGCGGAGCAGGGGGCGG + Intergenic
1071497695 10:86180074-86180096 GGGCAGGGCGGAGCAGGAGCAGG + Intronic
1071544882 10:86521662-86521684 GGAAGCGGCGGCGCAGGAGGCGG - Exonic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1073098937 10:100997178-100997200 GGGCGCGCTGGAGCAGGAGCGGG + Intronic
1073268306 10:102241440-102241462 CGGAGAGGCGGCCCGGGAGCAGG - Exonic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1073340924 10:102744025-102744047 CGTGGCGGAGGAGCAGGAGCAGG + Exonic
1073357552 10:102869458-102869480 CGGGGCCTCGGCACAGGAGCTGG + Intronic
1074121536 10:110497558-110497580 CGGGGCGGCGCCGCACGATCCGG - Intergenic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1075768941 10:124917229-124917251 CGGGGAGGAGGAGCAGGAGCTGG + Intergenic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076035469 10:127195954-127195976 GGGCGCGGGGGCGCGGGAGGAGG + Intronic
1076374189 10:129972701-129972723 CGGGGCTGCGGCGGAGGCGCGGG - Intergenic
1077049659 11:560988-561010 GGTTGCGGCGGCGCCGGAGCGGG + Intronic
1077065076 11:637403-637425 GGGCGCGGCGGCGCTGGTGGGGG + Exonic
1077093312 11:789156-789178 GGGCGGGGAGGGGCAGGAGCTGG + Intronic
1077514226 11:2992113-2992135 CGGGGCGGTGGGGCAGGGGCGGG - Intronic
1077923058 11:6655767-6655789 CGGGGCGGCTGTGCAGGAGGCGG - Exonic
1078771741 11:14358547-14358569 GGGCGCGGCGTCGCGGGAGTAGG - Intronic
1080551505 11:33376701-33376723 CGACGCGGGGGCGCGGGGGCCGG + Intergenic
1081846426 11:46243715-46243737 CGGATCGGGGGCGCAGGAGAGGG - Intergenic
1081872958 11:46391588-46391610 CTCCGCGGCGGCGCGGGGGCGGG - Intergenic
1083595979 11:63918417-63918439 TGGCTCGACGGCGCAGCAGCCGG - Intergenic
1083970452 11:66070860-66070882 CGGCGGGGCGCCGGGGGAGCGGG + Intronic
1084758306 11:71252544-71252566 CGCCGCCGCGGCTCAGGTGCAGG + Intronic
1085666218 11:78417615-78417637 GGGCGCGGCCGCCCAGGGGCGGG - Intronic
1085726841 11:78961963-78961985 CGGCGCCGCGGGGCAAGAGCGGG + Intronic
1086064903 11:82733799-82733821 CGCCGCGCCGGGGCGGGAGCTGG - Exonic
1086450019 11:86906424-86906446 CGCCGGGGTGGCGCAGGGGCGGG - Intronic
1087014625 11:93543241-93543263 CGGCGCGGCGGCGGCGGCGGCGG - Intronic
1088604473 11:111514717-111514739 CGGAGGGGCGGGGCAGGGGCGGG + Intergenic
1088893082 11:114059668-114059690 CGCGGCGGAGGCGCAGCAGCCGG + Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1090673861 11:128970973-128970995 CGGCGCGCAGGTGCAGCAGCGGG + Exonic
1090845794 11:130528769-130528791 GGGAGCAGCGGTGCAGGAGCGGG + Intergenic
1091318419 11:134632481-134632503 CAGCACGGCAGTGCAGGAGCCGG + Intergenic
1092204613 12:6607344-6607366 CGGCGAGGAGGAGCCGGAGCGGG - Exonic
1093711566 12:22334676-22334698 CGGCGCAGCAGCGCGGGAGGCGG - Exonic
1093958853 12:25251116-25251138 CGGGCCGGCGGGGGAGGAGCGGG + Intergenic
1094841452 12:34344240-34344262 CGGCGCGGCAGAGCAGGGTCGGG - Intergenic
1095753012 12:45730467-45730489 CGGGCGGGCGGCGCGGGAGCGGG - Intronic
1096191539 12:49623360-49623382 GGACGCGGCGGCGCGGGGGCGGG + Intronic
1096241325 12:49961794-49961816 CGGCGCGGGGGGGCAGGGGGCGG - Intergenic
1096489571 12:52006477-52006499 CAGCGGGGCTGCGCAGGAGTAGG - Intergenic
1096647633 12:53047321-53047343 CGGCGGGGCGGGGCAGCAGCAGG - Intronic
1100591640 12:96035435-96035457 CGACGCTGCAGCGCAGGTGCAGG + Exonic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1101466919 12:104958352-104958374 CGGCGCGGCTGCGCTTGCGCGGG - Intronic
1102256442 12:111418247-111418269 CGTAGCGGCGGCCCGGGAGCTGG + Exonic
1103096417 12:118136299-118136321 CGGGGCGGCGGTGGACGAGCTGG + Exonic
1103400671 12:120640990-120641012 CGGCGTCGCCGGGCAGGAGCCGG - Exonic
1103649684 12:122422777-122422799 CGGCGGGGCGGCGCGGGGCCGGG - Intergenic
1103779400 12:123389114-123389136 CGCCGCGGCGGCGCTGGTGGCGG + Intronic
1103856556 12:123973836-123973858 CCGGGCGGCTGCGGAGGAGCCGG + Exonic
1104964234 12:132501788-132501810 CAGGGCGGCTGAGCAGGAGCTGG + Intronic
1105217474 13:18297568-18297590 CGCCGCGGCGGCGCTGGTGGCGG + Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105539002 13:21298303-21298325 CGGCTCTGCGGCGCAGGCGGCGG + Intergenic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1105851583 13:24340406-24340428 AGGTGCGGCGGTGCAGGAGCAGG + Intergenic
1107891442 13:44918087-44918109 CTCCGCGCAGGCGCAGGAGCAGG - Intergenic
1110436466 13:75482114-75482136 CGGGGCTGCAGCGCTGGAGCCGG - Exonic
1112504962 13:99970066-99970088 AGCGGCGGCGGCGCAGGAGCTGG + Intronic
1113254805 13:108495582-108495604 AGGCGCGGCGCCCCGGGAGCTGG + Intergenic
1113513721 13:110874798-110874820 CGGGGCGCCGGCGCGGGTGCAGG - Intergenic
1113656198 13:112068891-112068913 CGCCGGGGCGGGGCGGGAGCCGG - Exonic
1113806131 13:113110721-113110743 TGGCGCGCCGGCGCCGGTGCAGG - Exonic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115566642 14:34630197-34630219 CGGGGCGGAGGCGAAGGGGCGGG + Intergenic
1116932600 14:50704760-50704782 CAGGGCGGCTGCGCTGGAGCAGG + Intergenic
1118351001 14:64972368-64972390 CGGGGCGGCGGCGGCGGCGCAGG - Intronic
1118607678 14:67515346-67515368 CGCCGCGGCGGCGCGGGGTCCGG + Intronic
1119261011 14:73237991-73238013 CGGGGTGGCCGCGCAGGTGCCGG - Intronic
1121617066 14:95320104-95320126 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1122666652 14:103334607-103334629 GGGCGCGGCGGGCCAGGAGATGG + Intronic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122942040 14:104985842-104985864 CGGCGGGGCCGCGCGGGACCAGG - Exonic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1127515427 15:59689090-59689112 CGGCACGGTGGCTCCGGAGCTGG - Intronic
1127606507 15:60592469-60592491 CGGCGCGGCGGCGGCAGAGGGGG - Intronic
1128622477 15:69161540-69161562 GGGCGCGGCTCCGCAGGCGCTGG + Intronic
1129752818 15:78077679-78077701 CGGCGCGGAGGCGCAGGGCGCGG - Intronic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130301157 15:82680572-82680594 CGGCGCTGCGGCTCTGCAGCAGG + Exonic
1132342351 15:101086510-101086532 AGCCGCGGCCGCGCAGGCGCCGG - Intergenic
1132930320 16:2455692-2455714 CTCCCCGGCGGGGCAGGAGCTGG - Intronic
1133049117 16:3106651-3106673 CGGCGGGGCGGGGCTGGGGCGGG + Intergenic
1134172082 16:11976768-11976790 CGGCGGCGCGGCGCAGGCACCGG + Exonic
1134256295 16:12614596-12614618 CGGCGCGGTGGGGGAGGGGCGGG - Intergenic
1135382699 16:22008013-22008035 GGGCGCGGCGGCTGGGGAGCCGG + Intronic
1135976149 16:27109951-27109973 GGGCGCGGCGGGGCGGGAGCGGG - Intergenic
1136261777 16:29082244-29082266 CCACTCTGCGGCGCAGGAGCCGG - Intergenic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1137236315 16:46621272-46621294 CTGGGCGGTGGAGCAGGAGCTGG - Exonic
1137300477 16:47143826-47143848 GGGCGCCGCGGAGCAGGAGGCGG - Exonic
1138105884 16:54286948-54286970 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1142876309 17:2853689-2853711 CGGCGCGTCTGAGCGGGAGCCGG + Intronic
1143053065 17:4142736-4142758 CGCCGCGGCGCTGCTGGAGCCGG - Exonic
1143099872 17:4499083-4499105 CGGCGCGGAGGAGGAGGAGGCGG + Exonic
1143099877 17:4499109-4499131 CGGAGCGGCGGCGCCGGCGCCGG + Exonic
1143487223 17:7261660-7261682 CGGCGGGGCTGGGCGGGAGCGGG - Intronic
1143562139 17:7702584-7702606 CTGGGCAGCGGGGCAGGAGCAGG + Intronic
1143669559 17:8387090-8387112 TGGGGGGGCGGCGTAGGAGCTGG + Intergenic
1144339741 17:14301673-14301695 CGGCGCGGCGGCGCAGGAGCCGG - Exonic
1144656953 17:17042823-17042845 CGGCGCGGCGGCGACGGCGGCGG - Exonic
1145086590 17:19947142-19947164 CGGCCCGGCTGCTCAGCAGCGGG + Intronic
1145935516 17:28712419-28712441 CTGCGGGGTGGCGCAGGGGCTGG - Intergenic
1146053309 17:29568665-29568687 CGGCGCGGGGGCGCTGGGGCTGG + Exonic
1146167348 17:30600508-30600530 GTGCTCGGCGGCGCCGGAGCAGG - Intergenic
1146322791 17:31859359-31859381 GGGCGGGGCGGCGCAGGGGGCGG + Intergenic
1147015795 17:37490207-37490229 CGGCGCGGCGGGGGAGCGGCAGG - Intronic
1147184261 17:38705210-38705232 CGGGGGGGCGGCGCGTGAGCGGG + Intergenic
1147588395 17:41666092-41666114 CGGCGCGCGTGCGCAGGAGGAGG - Intergenic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1147705377 17:42422049-42422071 GGGCGCGGGGGCGCAGGGTCTGG + Intronic
1148156975 17:45430153-45430175 CGGTGCTGCGCCGCAGCAGCCGG + Intronic
1148262162 17:46193271-46193293 CGCCGCGGCGGCGCGGGGGGCGG - Intronic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1148615786 17:48998504-48998526 TGGCGCGGCGGCGGCGGCGCCGG + Intronic
1148786578 17:50148887-50148909 CGGCGGGGCGGGGCAGCAGGCGG + Intronic
1149430473 17:56593197-56593219 GCTCGCGGCGGCGCTGGAGCCGG - Intergenic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150675739 17:67245024-67245046 GGGCGCGGCGGCCCCGGGGCAGG - Intronic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1150764626 17:67993546-67993568 CGCGGCGGCGGCGCGGGCGCGGG + Intronic
1151383812 17:73743163-73743185 TGGGGCCGCGGAGCAGGAGCAGG - Intergenic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1151662346 17:75525593-75525615 CAGCTCGGCGCCGCAGGGGCGGG - Intronic
1151854393 17:76710755-76710777 CGGCTCGGGGGCGCAGGGGCGGG + Exonic
1152155900 17:78632527-78632549 GGGCGCGGTGGCTCAGGGGCTGG - Intergenic
1152654407 17:81513165-81513187 GGGCGGGGCCGCGCCGGAGCTGG + Intronic
1152660756 17:81540873-81540895 CTGGGCGGTGGCACAGGAGCTGG + Exonic
1152821594 17:82440302-82440324 AGGCGCGGCGGCCCAGGGACGGG + Intronic
1152885482 17:82846694-82846716 CGGAGCAGCAGCCCAGGAGCGGG + Intronic
1152891440 17:82883807-82883829 TGGTGGGGCGGCGCAGGAGGTGG - Intronic
1152952843 18:11075-11097 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1152952851 18:11110-11132 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG + Intronic
1155209203 18:23586444-23586466 AGGAGCGGAGGAGCAGGAGCAGG + Exonic
1155392740 18:25352361-25352383 AGGGGCGGCGGCGCAGGAGCGGG - Intergenic
1155557287 18:27033866-27033888 CTGAGAGGCGGCACAGGAGCCGG - Intronic
1156495800 18:37524575-37524597 CGGCGGGGCAGCCCCGGAGCGGG + Intronic
1157222482 18:45837895-45837917 AGGCGAGGCGGCGTGGGAGCGGG + Exonic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1158453461 18:57586755-57586777 CGGCCCGGCAGCGAATGAGCGGG - Intronic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1160543656 18:79638761-79638783 AGACGCGGCGGCGCTGGGGCTGG + Intergenic
1160653411 19:246523-246545 CGGCGCGCCGGCGCCGGCGCAGG + Intergenic
1160909250 19:1467300-1467322 CGGCGCCGCGGACCAGGAGCTGG + Exonic
1160930274 19:1567065-1567087 CGGCGGGGCGGGGCAAGCGCAGG - Intronic
1160961866 19:1725716-1725738 CCGCGCGGGGGCGCATGCGCGGG + Intergenic
1160971005 19:1767749-1767771 GGGGGCGGCGGCGCAGGCCCAGG + Intronic
1161425038 19:4198541-4198563 CGGGGAGGGGGCGCAGGAGCGGG + Intronic
1162312116 19:9913850-9913872 CGGCGCGGAGGCGCGGGAGGGGG - Intronic
1162398580 19:10431728-10431750 GGGCACGGCGGGGCAGGACCGGG + Intronic
1162907787 19:13833785-13833807 ACGCGCGGCGGGGCAGGAGGTGG - Intergenic
1162968764 19:14167877-14167899 GGGCCCGGGGGCCCAGGAGCTGG + Intronic
1162987146 19:14277934-14277956 CGGCGCCGCGGAGCAGGGGGCGG - Intergenic
1163219325 19:15903119-15903141 CGGCGTGGCCGCGCAGGTGGAGG - Intergenic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1163651795 19:18522087-18522109 CGGCGTGGCGGCGCTGGAGCCGG - Exonic
1163666634 19:18606691-18606713 CGGCTCGGCGGCGGTGGCGCAGG + Exonic
1164594816 19:29526002-29526024 CGGCGTGGCGGACCCGGAGCCGG - Intergenic
1165058728 19:33194739-33194761 CGGAGCCGCGGGGCAGGAGGCGG + Exonic
1165129229 19:33621872-33621894 CGGCGGGGCGGGGCACGGGCCGG + Intergenic
1165204518 19:34172451-34172473 CGGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165940648 19:39413355-39413377 CGTCGGGGTCGCGCAGGAGCCGG + Exonic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
1167691142 19:50984114-50984136 ATGTGCGGGGGCGCAGGAGCTGG - Intergenic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
1168685674 19:58347725-58347747 CGGGGCTGAGGCGCAGGCGCGGG - Intronic
925045829 2:772492-772514 CAGAGCGGGGGCCCAGGAGCTGG + Intergenic
925610152 2:5695945-5695967 CTGCGCGGAGGCTCGGGAGCTGG + Exonic
925927197 2:8678968-8678990 GGCCGCGGCGGGGCCGGAGCCGG - Exonic
927111739 2:19868832-19868854 CGGCGAGGAGGAGCAGGAGGGGG - Intergenic
927168761 2:20350937-20350959 CGCGGCGGCAGCGCGGGAGCAGG - Intronic
927943250 2:27118842-27118864 CCGCGCGGCGCCGCAGCAGGTGG - Exonic
929936768 2:46298829-46298851 CTGCGCGGCCGCGCAGAAGCAGG + Intronic
929983187 2:46699483-46699505 CGGCGCGGGGGCCGGGGAGCAGG - Intronic
931253397 2:60551864-60551886 CGGCGCGGCAGCCCCGGAGCAGG - Intronic
932231346 2:70086886-70086908 CGCCGCCGGGGAGCAGGAGCTGG + Intergenic
932591530 2:73070806-73070828 CGGCGCGGGGGCCCGGGCGCGGG + Intronic
933666714 2:84970832-84970854 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
935971500 2:108534406-108534428 CCGCGCGGGGGCGCGGGAGGGGG - Intronic
937956259 2:127423200-127423222 CGGCGGGGCGGGGCTGGGGCCGG + Intronic
940009529 2:149038968-149038990 CGGGGCCGCGGCGCAGTGGCGGG + Intronic
940293220 2:152098260-152098282 CGGCGCGGGGGTCCTGGAGCCGG - Intronic
940517448 2:154698724-154698746 CGAAGCGAAGGCGCAGGAGCTGG - Exonic
941104901 2:161341135-161341157 CGGCTCGGGGGCGCAGGGGCGGG + Intronic
942449441 2:176099965-176099987 CTGCGCGGGGGCGCAGGAGGCGG - Exonic
946313986 2:218897627-218897649 CGGGCGGGCGGCGCAGGGGCGGG - Intronic
946327875 2:218993977-218993999 CGGGGGCGCGGCGCAGGATCTGG - Intergenic
946921419 2:224585146-224585168 CGCCGCGGCTGCCCAGGGGCCGG - Exonic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
947741725 2:232487824-232487846 CGGCGCGGCGGCAGAGGAGGCGG - Exonic
947992337 2:234497252-234497274 CGGCGCGGCGCGGGAGGGGCCGG - Intergenic
948216698 2:236237756-236237778 CGGCGCGGTGCTGCAGCAGCAGG + Exonic
1169065600 20:2692885-2692907 CGGCGGGGCGGCGCGGGAACCGG + Exonic
1169214726 20:3786509-3786531 CGGGGCGGCGGCGGCGGCGCCGG - Exonic
1170674519 20:18467005-18467027 CCGGGCGGCGGCGAAGGAGGAGG - Exonic
1171458246 20:25283796-25283818 CGGCGGAGCAGCGCGGGAGCGGG - Intronic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1173605195 20:44326758-44326780 AGGCGCGGGGGCGCGGGGGCGGG + Intergenic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1174645871 20:52084965-52084987 CAGGGCGGCCGCGCTGGAGCAGG + Intronic
1175108227 20:56629218-56629240 CGGCGCGGAGGCCCAGGCGCCGG - Intergenic
1175847003 20:62064796-62064818 CGGCGCGGCGGCTGCGGCGCCGG - Exonic
1176549009 21:8213556-8213578 CGGCGCGGCCGAGCCGGAGGCGG - Intergenic
1178162851 21:29939278-29939300 GCGCGCGGCGGCGCAGGAGCCGG - Intronic
1178417108 21:32412817-32412839 CGGGGCGGAGGCGCAGGCCCGGG - Exonic
1178707747 21:34889175-34889197 CTGGGCGGCCGCGCAGGATCTGG - Intronic
1178948355 21:36966500-36966522 CGGCGCGGCCGCGCAGCCCCCGG - Intronic
1179675040 21:42975109-42975131 CGGCGGGGCGGGGCCGGGGCGGG + Intronic
1179882668 21:44300049-44300071 CGGCGACGCGGCGCAGGCGGCGG + Exonic
1182237003 22:28883814-28883836 GGGGGCGGCGGCGCAGGCGGCGG - Exonic
1182639306 22:31753924-31753946 CGGCGCGGGGGCGCGAGGGCGGG + Intergenic
1183961473 22:41414044-41414066 AGGCGAGGCGGCGCTGGAGGAGG - Intergenic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185397452 22:50600376-50600398 GGGCGCGGCGGCGCAGCTCCCGG + Intronic
950168030 3:10816216-10816238 CGGGGCGGCGGCGCAGAGCCGGG + Exonic
950902992 3:16513689-16513711 GGGCGCGTCGGGGCTGGAGCCGG - Exonic
952241279 3:31533136-31533158 CGGCGCGGCGCCGCCGAAGCCGG + Exonic
952301241 3:32106459-32106481 GGGCGGGGCGGTGCCGGAGCCGG + Intronic
953801087 3:46023129-46023151 CGCGGCGGCGGCGCAGGGGGCGG + Intronic
954035373 3:47848390-47848412 CGGCGGGGCGGGGCAGGGGCTGG + Intronic
954540777 3:51391785-51391807 AGGCGCGGCCGCGGATGAGCCGG - Exonic
954656646 3:52198070-52198092 CGGCGCGCCTGCGCAGAAGAAGG + Intronic
955161435 3:56468316-56468338 CGGCCAGGAGGAGCAGGAGCCGG + Exonic
955818800 3:62874863-62874885 GGGGGCGGCGGCGCCGGCGCCGG - Exonic
958026892 3:88059273-88059295 GGCGGCGGCGGCGCAGGGGCTGG + Exonic
960582625 3:119294093-119294115 CGGCTCGGCGGGGCAGGAAGCGG + Intergenic
961013255 3:123449305-123449327 CGGCGCGTCCGCGCAGGGGGCGG + Exonic
966108162 3:176362257-176362279 CGGCGCCGCGGAGCAGGGGGCGG + Intergenic
966390913 3:179451504-179451526 CGGCGCGCCGGAGCCGGGGCGGG + Exonic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966743392 3:183254068-183254090 AGGCGCGGCGGGGCGGGGGCGGG - Intronic
966868585 3:184276087-184276109 CGGGGCCGCGGCCCGGGAGCGGG + Intronic
967762493 3:193241328-193241350 CAGCGTGGCGGCGCTGGTGCTGG + Exonic
968092894 3:195909330-195909352 GGGCCCGGCGGTGCAGGAGGAGG - Intronic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968353288 3:198080541-198080563 AGCCGCGGGGGCTCAGGAGCCGG - Intergenic
968452375 4:681606-681628 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452384 4:681626-681648 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452393 4:681646-681668 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452402 4:681666-681688 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452411 4:681686-681708 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452420 4:681706-681728 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452429 4:681726-681748 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968701331 4:2059484-2059506 CGGCCGGGCGGCGCGGCAGCGGG - Intergenic
968911046 4:3477145-3477167 CGCCGGGGCTGTGCAGGAGCAGG + Intronic
968965245 4:3766238-3766260 CGGCGACGCGGCGCCCGAGCGGG - Intergenic
969138752 4:5051494-5051516 ACGCGAGGCGGCGCGGGAGCAGG - Exonic
969239117 4:5888005-5888027 TGGCGGGGCGGGGCTGGAGCCGG - Intronic
969368645 4:6716380-6716402 CGGCGCGGCGAAGCAGCGGCAGG - Exonic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
973557992 4:52105399-52105421 CGGCTCGGCGGGTCAGGAGTTGG - Intergenic
975683331 4:76897270-76897292 CTGCGCGGCGGCGAAGACGCAGG - Exonic
975800834 4:78057822-78057844 CAGCCCGGAGGCGCCGGAGCGGG - Exonic
976743381 4:88379229-88379251 GGGCGCGGGGGCCCAGGTGCAGG + Intronic
978795744 4:112705992-112706014 CCACTCTGCGGCGCAGGAGCCGG + Intergenic
979539969 4:121870158-121870180 TGGTGCGGAGGCGAAGGAGCCGG - Intronic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
985462604 4:190121393-190121415 CGCCGGCGCGGCGCCGGAGCGGG - Intergenic
985695597 5:1338388-1338410 CGGAGCTGTGGCGCAGGAGTTGG + Intronic
985743506 5:1633757-1633779 CGGGGCGGCTGCGCGGGAGGCGG + Intergenic
987015102 5:13810173-13810195 CGCGGGGGCGGCGCTGGAGCTGG - Exonic
992118504 5:73565694-73565716 CAGCCCGGCGGCGCAGAGGCGGG - Intronic
995853706 5:116572936-116572958 CGGAGGGGCGGCGAGGGAGCGGG + Intronic
996082147 5:119268534-119268556 CTGGGCGGCGGCCCGGGAGCCGG - Intergenic
996404293 5:123090637-123090659 CGGGGCGCCGGCGCCGGCGCCGG + Intronic
996443034 5:123512694-123512716 GGGGGCGGCGCCGCAGGCGCGGG + Intronic
997899867 5:137754462-137754484 CGGCGCTGCGGCGCGGTAGGCGG - Intergenic
998435877 5:142108669-142108691 CGGGGCGGCGGCGCAGGACTAGG + Exonic
998583617 5:143404199-143404221 CGGCCCGGCGGCGGCGGCGCGGG - Intronic
999326939 5:150649598-150649620 CCCCGCGGCGGCGGAGGAGGTGG + Exonic
1001529996 5:172454701-172454723 CGGCGCGGCGGCTCAGCACCGGG - Intergenic
1002594331 5:180312227-180312249 CAGCGCGGCAGCGCAGGGGGAGG + Intronic
1002897681 6:1389153-1389175 CGGCCCGGCGGGCCAGGAGGAGG + Intergenic
1003049429 6:2766096-2766118 CGAGGCGGAGGCGCAGGAGGAGG + Exonic
1003058219 6:2841775-2841797 CGGAGCGGTGGCGCGGGGGCGGG - Intronic
1007585103 6:42984634-42984656 CGGAGCGGGGCCGCAGGAGACGG + Exonic
1009437566 6:63635829-63635851 TGCGGCGGCGGCGCGGGAGCTGG - Exonic
1010141750 6:72621595-72621617 CGGCGCAGCGACGTAGCAGCGGG + Intergenic
1011517131 6:88166589-88166611 GAGCGCGGCGGCGGAGGAGGAGG - Intergenic
1016400738 6:143677852-143677874 CGGGGGGAGGGCGCAGGAGCAGG - Intronic
1017164159 6:151391554-151391576 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017170725 6:151452148-151452170 CAGTGCGGCTGCGCAGTAGCGGG - Intronic
1017446415 6:154510585-154510607 CGGGAGGGCGGCGCAGGAGGTGG - Exonic
1017672010 6:156777815-156777837 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1019531274 7:1504564-1504586 CGGCGGCGCGGGGCAGGCGCTGG + Intergenic
1019537580 7:1537277-1537299 GGGCCCGGGGGCCCAGGAGCGGG + Intronic
1019641156 7:2104364-2104386 CGTCACGGCGGCGCAATAGCAGG + Intronic
1020238467 7:6374468-6374490 GGGAGCGGCGGCGCCGGCGCGGG + Intergenic
1020252976 7:6484084-6484106 CAGCGCGGCGGCCCCGGGGCTGG + Exonic
1021868185 7:24979582-24979604 AGGGGCCGCGGCGCAGGTGCGGG - Intronic
1021925423 7:25529547-25529569 CGGCGAGGCAGAGCAGGGGCCGG - Intergenic
1022427641 7:30284481-30284503 TGGCGAGGCGGAGCAGGGGCAGG + Exonic
1023287107 7:38631404-38631426 CGGCGCGGAGGAGCGGGAGGAGG + Exonic
1024499819 7:50093150-50093172 CAGCGCGGCGGGGCAGGCGGCGG - Exonic
1026840414 7:73667721-73667743 CGGCGCGGCGCGGCCGGGGCGGG + Intergenic
1027361674 7:77416206-77416228 GGAAGCGGCGGCGCAGGTGCGGG - Exonic
1028121431 7:87059747-87059769 CGGGGCGGGGACGCTGGAGCTGG + Intergenic
1028621433 7:92833341-92833363 CGCCGCGGCGCCGCTGGGGCGGG + Exonic
1029640518 7:101816689-101816711 CGGCGCGGCGGAGCTGGGGCTGG + Intronic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1036390271 8:8318814-8318836 AGGCGGGGCGGCAGAGGAGCAGG + Exonic
1037984126 8:23276192-23276214 GGGTGCGGAGGCGCAGGGGCTGG - Intronic
1038542494 8:28401844-28401866 CGGAGCCGCGGCCCCGGAGCCGG - Intronic
1039874990 8:41577985-41578007 GGGCGGGGCGGGGCAGGAGCAGG - Intronic
1040077093 8:43247140-43247162 AGCCGCGGCGGCTCAGGAGCGGG + Intergenic
1041167264 8:55102346-55102368 AGGCGAGCCGACGCAGGAGCAGG + Intergenic
1041244757 8:55879833-55879855 CGGCGCGGCGGGAGAGGAACTGG - Exonic
1041464541 8:58145713-58145735 CCGCGCGTCGGCGCAGGCGGGGG + Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1041910704 8:63085914-63085936 CGGCGCTGCGGCGCCGGGCCCGG - Exonic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1045737922 8:105318458-105318480 CGGAGCGGCGGCGGCGGCGCCGG + Intronic
1046547417 8:115669073-115669095 CGGGGCGGCGGCGGCGGCGCGGG - Intronic
1049237270 8:141518597-141518619 CGGCGGGGCCGGGCAGCAGCAGG - Exonic
1049649942 8:143761203-143761225 CGGCGGGGAGCCGGAGGAGCAGG - Intergenic
1049761190 8:144332701-144332723 GGCCGGGGCGGAGCAGGAGCGGG - Exonic
1049896241 9:113910-113932 GGGGGCGGCGGCGCAGAGGCCGG + Intergenic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1052807363 9:33025144-33025166 CGGCGCGGGGGCGCACGGGTCGG - Intronic
1052872845 9:33524441-33524463 AGCCGCGGCGTCTCAGGAGCGGG + Exonic
1053503260 9:38620312-38620334 AGCCGCCGCGGCTCAGGAGCGGG - Intergenic
1053655173 9:40211653-40211675 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1054367289 9:64357869-64357891 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1054400512 9:64711879-64711901 CGGCGGGGCGGCGGAGAGGCGGG - Intergenic
1054529426 9:66164661-66164683 TGGTGCTGCGGCCCAGGAGCTGG + Intergenic
1054674919 9:67847606-67847628 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1054905886 9:70413471-70413493 CGGCGCGGCGGCCAAGGGGGCGG + Exonic
1057152872 9:92809616-92809638 AGCCGCGGCGGCTCAGGAGCGGG + Intergenic
1057596233 9:96418048-96418070 CGGCCCGGGGCCGCCGGAGCTGG - Exonic
1057684581 9:97221262-97221284 AGCCGCGGCGGCTCAGTAGCGGG - Intergenic
1058861214 9:109119451-109119473 CGGCGCCGAGCAGCAGGAGCAGG + Exonic
1060629566 9:125143438-125143460 TCCCGCGGCGGAGCAGGAGCCGG - Exonic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061449385 9:130660241-130660263 CGGGGCTGGGGCGCAGGGGCTGG + Intergenic
1061489819 9:130938733-130938755 CGCCGGGGCGGCCCGGGAGCGGG + Exonic
1061489849 9:130938864-130938886 CGCCGGGGAGGCGCCGGAGCCGG - Intronic
1061961923 9:133992842-133992864 CGGCCGGGCGGGGCAGGGGCGGG + Intergenic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062022559 9:134326355-134326377 CGGCGCTGCGGCGCCGGCGGGGG - Intronic
1062398867 9:136363737-136363759 CGGCGGGGCGGGGCCGGGGCAGG - Exonic
1062659105 9:137619104-137619126 CGGCGCGGGGGCGAAGAACCGGG + Intronic
1062718698 9:138023667-138023689 CGGCGCGGCGGCACCGGGCCCGG + Exonic
1186768056 X:12791452-12791474 GCGCGCGGCGGCGGAGGAGGTGG - Exonic
1187403654 X:18984135-18984157 CGGCGGGGAGGCGCGGGGGCGGG + Exonic
1187464578 X:19515558-19515580 GAGGGCGGCGGGGCAGGAGCGGG + Intergenic
1189005106 X:36986372-36986394 AGCTGCGGCGGCGCAGGAGGGGG - Intergenic
1189043915 X:37571570-37571592 AGCTGCGGCGGCGCAGGAGGGGG + Intronic
1190062254 X:47219046-47219068 CGGCGCGGCGGCGCCTGGGGCGG - Intronic
1200155507 X:153972641-153972663 CGGGCCGGTGGCGCACGAGCCGG + Exonic
1200173766 X:154097639-154097661 CGGCGCGGCGGCGGCGGCGGCGG + Exonic