ID: 1144339746

View in Genome Browser
Species Human (GRCh38)
Location 17:14301685-14301707
Sequence GAGCAGCAGCCCCGGCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144339746_1144339757 20 Left 1144339746 17:14301685-14301707 CCGCCGCGCCGGGGCTGCTGCTC 0: 1
1: 0
2: 3
3: 58
4: 574
Right 1144339757 17:14301728-14301750 CGCACACGACCCGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144339746 Original CRISPR GAGCAGCAGCCCCGGCGCGG CGG (reversed) Exonic
900103473 1:972476-972498 GGGCAGCAGACCGGGCGTGGTGG + Intronic
900104239 1:975508-975530 GTGCAGCAGCCCCTGCAGGGTGG - Exonic
900161744 1:1227279-1227301 GAGCACCAGGCCCGGCGGGAAGG + Intronic
900236183 1:1592228-1592250 GAGAAGCTGGCCGGGCGCGGCGG + Intergenic
900332069 1:2140363-2140385 GAGCAGGAGGCCGGGCGCGGTGG + Intronic
900366832 1:2314955-2314977 GAGCAGCAGGCCCGGGCTGGGGG + Intergenic
901076271 1:6556687-6556709 GAAAAGCAGGCCGGGCGCGGTGG - Intronic
901181507 1:7345036-7345058 GAGCAGGAGGCTGGGCGCGGTGG - Intronic
901504738 1:9677356-9677378 CAGCAGCAGACCAGGTGCGGTGG + Intronic
902089711 1:13893313-13893335 GAGAAGCAGCCCCGGGCCGGGGG + Intergenic
902853706 1:19183432-19183454 GAGCTACAGGCCGGGCGCGGTGG + Intronic
903140139 1:21334471-21334493 GAACAGCAGCCCTGGAGCAGAGG + Intronic
904034254 1:27550600-27550622 GAGCAGCAGCCTGAGCGTGGAGG - Exonic
904205084 1:28849113-28849135 GAGCAGGAGGCCAGGCACGGTGG + Intronic
905409981 1:37761897-37761919 CAGCAGCATCCCTGGCGCCGCGG - Exonic
905618747 1:39421785-39421807 AAGCAACAGGCCGGGCGCGGTGG + Intronic
906336603 1:44937594-44937616 CTGCAGCAGACCGGGCGCGGTGG + Intronic
906348152 1:45034137-45034159 GAGCACCTGGCCAGGCGCGGTGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906719756 1:47996760-47996782 GAGCAGCGGCCCCGCCAGGGCGG + Exonic
907110957 1:51925951-51925973 GAGGAGCAGCCCCTGCTGGGGGG + Intronic
907205430 1:52766385-52766407 GAGTAACAGACCAGGCGCGGTGG - Intronic
907278101 1:53327991-53328013 CAGCGGCAACCCCGGCGCCGCGG - Exonic
910943745 1:92565679-92565701 TAGCAACAGGCCAGGCGCGGTGG + Intronic
911444282 1:97971137-97971159 GATCAGCAGGCCGGGCGCGGTGG + Intergenic
912561523 1:110555043-110555065 GATCAGCAGCCCCCGCACGGTGG + Intergenic
912685534 1:111759685-111759707 GAAGAGCAGGCCGGGCGCGGTGG + Intronic
912690466 1:111801065-111801087 GAGAAGCAGCCCCGGGGAGAAGG - Intronic
913138985 1:115921722-115921744 GAGGAGAAGGCCAGGCGCGGTGG + Intergenic
913293222 1:117294518-117294540 GAGAGGCAGGCCGGGCGCGGTGG + Intergenic
913453559 1:119008426-119008448 GAGGGGCTGGCCCGGCGCGGCGG + Intergenic
914455351 1:147831652-147831674 GAGCAGCTGCCCGGGCGCGGTGG - Intergenic
914706634 1:150175516-150175538 CATCAGCAGGCCGGGCGCGGTGG - Intergenic
915348027 1:155207942-155207964 GAGCAGGAGCCGGGGGGCGGAGG + Intronic
915459427 1:156061023-156061045 GAGAAGCAGCTCCAGCGGGGGGG - Intergenic
915805581 1:158845525-158845547 GAGCAGGAGGCCGGGCGCGGTGG - Intronic
915934782 1:160084067-160084089 GAGGAGCCGCCGCGGCGCCGCGG + Exonic
916655543 1:166872382-166872404 GATCTGCAGGCCGGGCGCGGTGG + Intronic
916717138 1:167455544-167455566 GAGCAGCAGCCCCGCCCCGCCGG + Intronic
916773634 1:167937011-167937033 GAGCGGGGGCCCCGGGGCGGAGG + Intronic
917876996 1:179294818-179294840 GACCAACAGGCCAGGCGCGGTGG - Intronic
918312631 1:183296135-183296157 GAGCTGCCGGCCGGGCGCGGTGG - Intronic
918482035 1:184989292-184989314 TAAAAGCAGCCCGGGCGCGGTGG + Intergenic
919551601 1:198996357-198996379 GACGAGCAGGCCGGGCGCGGTGG - Intergenic
919875685 1:201865493-201865515 CAGCTGCAGGCCGGGCGCGGTGG - Intronic
919897545 1:202018558-202018580 GACCAGCAGCTCCGGCAGGGCGG - Intergenic
919905909 1:202078225-202078247 CAGCAGCAGGCCGGGCGCGGTGG - Intergenic
921715709 1:218415405-218415427 GATGAGCAGGCCGGGCGCGGTGG + Intronic
922648830 1:227318846-227318868 GAGCCGGGGCCACGGCGCGGCGG - Intergenic
923825172 1:237492317-237492339 GAGATGAAGCCCAGGCGCGGTGG - Intronic
924548892 1:245055608-245055630 GAGAAACAGGCCAGGCGCGGTGG - Intronic
924775161 1:247111337-247111359 GCGCCGCAGCCCCAGCGCGCGGG + Exonic
1063028154 10:2203476-2203498 GAGCAGCCAGCCGGGCGCGGTGG - Intergenic
1063111995 10:3046006-3046028 AAGCAGCTGACCCGGGGCGGGGG + Intergenic
1063776695 10:9273211-9273233 GGGCAGCCGCCCCGTCGCAGAGG - Intergenic
1064209034 10:13347975-13347997 AAGCGGCGGGCCCGGCGCGGGGG - Intronic
1064373000 10:14770235-14770257 AAACAGCAGACCTGGCGCGGTGG + Intronic
1065407624 10:25387799-25387821 GAGGAGAAGCCCAGGCACGGTGG - Intronic
1065469785 10:26065828-26065850 GAGCAGTGGGCCGGGCGCGGTGG + Intronic
1065970518 10:30802650-30802672 GACCATCAGGCCAGGCGCGGTGG + Intergenic
1066395144 10:35013051-35013073 GAGCTGTAGGCCAGGCGCGGTGG + Intronic
1067959849 10:50836087-50836109 GAGCAGCTGCCATGGCGAGGAGG - Exonic
1068717080 10:60200442-60200464 GAGCAGCACCCCTGGCACAGTGG - Intronic
1069541208 10:69295260-69295282 GCGCAGCAGCACCGGAGCTGCGG - Intronic
1069971973 10:72179286-72179308 GAGCAGCAGGCCGGGCGCAGTGG - Intronic
1070367340 10:75750266-75750288 GGCCAGCCGCCCCGGCGGGGAGG - Intronic
1070609459 10:77923471-77923493 GAGCCACTGCCCCGGCGCAGGGG - Intronic
1070800109 10:79240155-79240177 GAGCTGCAGCCCCCGCGCTGCGG - Intronic
1072241123 10:93496530-93496552 GAGGAGCAGCGCGCGCGCGGCGG - Intergenic
1072562200 10:96586776-96586798 CAGCAGCAGCCACAGCGCGGCGG + Exonic
1073059357 10:100724290-100724312 GAGGAGGAGGCCGGGCGCGGCGG - Intergenic
1074503195 10:114044212-114044234 CACCAGCAGCCGCGCCGCGGTGG - Exonic
1075536939 10:123279164-123279186 GAGGAGCAGGCCAGGCGCAGTGG - Intergenic
1075687651 10:124375569-124375591 GAGCAGCAGAGCGGGCGCAGAGG - Intergenic
1076057633 10:127388713-127388735 GGGCAGAAGCCCCAGGGCGGGGG - Intronic
1076852443 10:133099696-133099718 GAGGAGCCGCCCCGGAGCTGTGG - Intronic
1077359470 11:2134300-2134322 GAGCAGGAGCCCCATCACGGGGG + Intronic
1078317557 11:10305585-10305607 GGGCAGGGGCCCCGGCGAGGCGG - Exonic
1078635810 11:13048810-13048832 ATGCAGCCGGCCCGGCGCGGTGG - Intergenic
1078659925 11:13278158-13278180 CAGCGGCAGCCCCCGCGAGGAGG - Intronic
1079362002 11:19777280-19777302 CAGCAGCGGCCCCGGGGCGGGGG + Intronic
1079378387 11:19914829-19914851 GAACAACAGGCCGGGCGCGGTGG - Intronic
1079921738 11:26441402-26441424 GGGCAGCAGGCCGGGCGCAGTGG - Intronic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1081300267 11:41442754-41442776 AAGCAACAGGCCGGGCGCGGTGG - Intronic
1081699948 11:45146705-45146727 CAGCGCCAGCCTCGGCGCGGCGG - Intronic
1081812823 11:45922917-45922939 CAGCAGCAGCAACAGCGCGGCGG - Exonic
1081860256 11:46329382-46329404 GAGATGCAGCCCTGGTGCGGTGG - Intergenic
1082821966 11:57550155-57550177 GCTCAGCAGCCACGGCCCGGGGG + Exonic
1083440913 11:62675951-62675973 AAGCAGCAGGCCGGGCGTGGTGG + Intergenic
1083818646 11:65152828-65152850 GAGTATCAGGCCAGGCGCGGTGG - Intergenic
1083873787 11:65509040-65509062 GAGCAGTCGGCCGGGCGCGGTGG - Intergenic
1083980320 11:66162407-66162429 GAACATCAGGCCAGGCGCGGTGG - Intronic
1084314093 11:68333948-68333970 AAGAAGCAGACCAGGCGCGGTGG + Intronic
1084956957 11:72696706-72696728 GCACAGCAGCCCAGGCGGGGTGG - Intronic
1084973922 11:72786062-72786084 GTGCAGCAGGCCGGGCGCGGTGG + Intronic
1085066665 11:73501812-73501834 TAGCAGAAGGCCGGGCGCGGTGG + Intronic
1085187856 11:74591479-74591501 GGGTAGCAGACCGGGCGCGGTGG - Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1086259076 11:84916056-84916078 AAGAAGCAGGCCGGGCGCGGTGG + Intronic
1087296163 11:96376713-96376735 GAAAAGCAGGCCAGGCGCGGTGG - Intronic
1087357372 11:97111721-97111743 GAGCAGTAGGCCGGGCGCAGTGG + Intergenic
1088653441 11:111977496-111977518 GTGCAGCAGCCCGGCCCCGGCGG - Intronic
1089520193 11:119058037-119058059 GCGCAGTCGCCCGGGCGCGGTGG + Intergenic
1090053779 11:123403829-123403851 GACAAGCAGGCCGGGCGCGGTGG - Intergenic
1090840034 11:130479389-130479411 GAGCAGCAGCACCGGGCAGGCGG - Intergenic
1090891177 11:130923795-130923817 GAGTAACAGGCCCGGCGCGGTGG + Intergenic
1091219317 11:133920790-133920812 CAGCAGCAGCCCTGGGGAGGTGG - Exonic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1092002796 12:5045279-5045301 GAGCAGCAGCCAGGGGGTGGAGG + Exonic
1092178325 12:6426463-6426485 GAGCATCAGGCCGGGTGCGGTGG + Intergenic
1092801051 12:12167354-12167376 GGACAGCAGTCCAGGCGCGGTGG + Intronic
1093919414 12:24843314-24843336 GAGCATGAGGCCAGGCGCGGTGG + Intronic
1095794398 12:46201903-46201925 GAGAAGTAGGCCCCGCGCGGTGG + Intronic
1095954084 12:47796709-47796731 AAGCAGGAGGCCGGGCGCGGTGG - Intronic
1096403318 12:51324660-51324682 GAGAAACAGGCCGGGCGCGGTGG + Intronic
1096733022 12:53629578-53629600 GAGCTTCAGGCCGGGCGCGGTGG - Intergenic
1096773846 12:53952424-53952446 GAGCAGCGGCCACAGGGCGGCGG - Intergenic
1098751463 12:74297804-74297826 GAGGAGTAGGCCGGGCGCGGTGG - Intergenic
1098922187 12:76312876-76312898 GAGCAGCGGGCTGGGCGCGGTGG + Intergenic
1100017248 12:90025478-90025500 GAGAAGCAGGCCGGGAGCGGTGG - Intergenic
1100769174 12:97902196-97902218 AAGCAACAGGCCAGGCGCGGTGG - Intergenic
1100985665 12:100199853-100199875 GCGCAGCAGCCGCAGCGCGAAGG - Intronic
1100999947 12:100347231-100347253 TAGAAGCAGGCCAGGCGCGGTGG - Intergenic
1101504214 12:105331103-105331125 GCGCAACCGCCCCCGCGCGGGGG - Intronic
1102176054 12:110875802-110875824 AAGCAGCTGACCTGGCGCGGTGG + Intronic
1102481450 12:113226754-113226776 GAGCAGCACCCCTGGCCCAGTGG + Exonic
1103459064 12:121089481-121089503 GAGCAGCTGCCCTGGCCAGGTGG + Intergenic
1103506744 12:121446106-121446128 GATCACCAGGCCGGGCGCGGTGG + Intronic
1103804611 12:123562711-123562733 GGGGAGCAGGCCGGGCGCGGTGG + Intergenic
1103930831 12:124449937-124449959 GAGCCACAGCCCTGGCACGGAGG + Intronic
1104119200 12:125782712-125782734 CAACAGCAGGCCAGGCGCGGTGG - Intergenic
1104710270 12:130980683-130980705 GAACTGCAGGCCGGGCGCGGTGG - Intronic
1104947598 12:132423556-132423578 GAGCAGCGGCCCCGGGAGGGCGG + Intergenic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1106782811 13:33076758-33076780 GAGCAGCAGCCCAGGGCAGGTGG + Intergenic
1108370416 13:49762218-49762240 GGCCAGCCGCCCCGTCGCGGAGG + Intronic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1112281805 13:98069290-98069312 AAGCAGAAGGCCGGGCGCGGTGG - Intergenic
1112676598 13:101709076-101709098 AAGCAGGAGGCCGGGCGCGGTGG + Intronic
1112761118 13:102694455-102694477 GCGCAGCAGCCTGGGCGCCGGGG - Exonic
1113416080 13:110129708-110129730 GCGCAGCAGCCCGGGTGGGGTGG + Intergenic
1113586491 13:111469552-111469574 CAGCAGCAGCCCTGGCTCAGAGG - Intergenic
1114530937 14:23395813-23395835 CAGCTGCAGGCCAGGCGCGGTGG - Intronic
1115028290 14:28766998-28767020 GAGCTTCACCCCCGGGGCGGTGG + Exonic
1115597102 14:34919982-34920004 GAGCAGTAGGCTGGGCGCGGTGG + Intergenic
1116813787 14:49565196-49565218 CAGCAGAAGGCCAGGCGCGGTGG + Intergenic
1117142562 14:52804554-52804576 AAGCAGCAGGCCAGGCGCGGTGG + Intergenic
1118292914 14:64541941-64541963 GAGCATCAACCCCGACGAGGCGG + Exonic
1118555509 14:67015409-67015431 AAACAGCAGCCCAGGCGCTGTGG + Intronic
1119172751 14:72547185-72547207 GAGCAGCAGCACCGCAGCAGAGG + Intronic
1119657090 14:76425034-76425056 GAGCATCAGGCCAGGCGCAGTGG - Intronic
1121039216 14:90731236-90731258 TAGCAGCAGGCCGGGCGCAGGGG - Intronic
1121041998 14:90757289-90757311 GAAAAGCAGTCCTGGCGCGGTGG + Intronic
1121300620 14:92867790-92867812 GGGCAGGAGTCCCGGGGCGGGGG + Intergenic
1122858492 14:104571623-104571645 CTGCAGCAGCCCCGGTGCAGTGG + Intronic
1122905823 14:104800991-104801013 CAGTAGCAGCTCCGCCGCGGGGG - Exonic
1123964080 15:25438498-25438520 CCGCCGCAGCCCAGGCGCGGGGG - Exonic
1124895155 15:33769664-33769686 GAGACGCAGGCCAGGCGCGGTGG + Intronic
1126087330 15:45022718-45022740 GCGCTGCAGGGCCGGCGCGGTGG + Intergenic
1126647564 15:50890237-50890259 GAAGAGCAGTCCAGGCGCGGTGG + Intergenic
1127784271 15:62342308-62342330 GAAAAGCAGGCCGGGCGCGGTGG + Intergenic
1128264011 15:66252570-66252592 GAGAAGCCGCCCGGGCTCGGGGG + Intronic
1128322667 15:66703914-66703936 GAGCAGCAGCTGCGGCGGCGCGG - Exonic
1128455666 15:67829996-67830018 GATGAGCAGACCAGGCGCGGGGG + Intronic
1129592751 15:76931861-76931883 CAGCAGCAGCCCCAACGCCGCGG - Exonic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1130383714 15:83393536-83393558 GTGGAGCAGGCCAGGCGCGGTGG - Intergenic
1130408586 15:83624971-83624993 GAGCACCAGGCCAGGCACGGTGG + Intergenic
1130541146 15:84821614-84821636 GAGCAGCAGCTCCCTCTCGGGGG + Intronic
1131632381 15:94193106-94193128 TAGCATCAGGCCGGGCGCGGTGG + Intergenic
1131972340 15:97904974-97904996 GAGCTGCTGGCCGGGCGCGGTGG + Intergenic
1132118431 15:99156181-99156203 GAGGAGCAGACCTGGCGCAGGGG - Exonic
1132850202 16:2021619-2021641 GAGAAGCAGGCCGGGTGCGGTGG - Intergenic
1133021628 16:2969453-2969475 CAGCCTCCGCCCCGGCGCGGGGG + Exonic
1133104965 16:3501493-3501515 GAACAGCAGGCCGGGCGCGGTGG + Intronic
1133260878 16:4549185-4549207 GAACACCAGGCCGGGCGCGGTGG + Intergenic
1133318298 16:4897629-4897651 GAGTAGCACCCCCGGTGCTGGGG + Intronic
1133774244 16:8885167-8885189 TACCTGCAGCCCCGGAGCGGAGG - Intergenic
1133865388 16:9637269-9637291 GAGAAGCAGGCCAGGCGCGGTGG + Intergenic
1134412844 16:14017341-14017363 CTGCAGCAGGCCGGGCGCGGTGG - Intergenic
1134509338 16:14833898-14833920 CAGCAGCAGCACCACCGCGGCGG - Exonic
1134697043 16:16232713-16232735 CAGCAGCAGCACCACCGCGGCGG - Exonic
1134974800 16:18561972-18561994 CAGCAGCAGCACCACCGCGGCGG + Exonic
1135329239 16:21547361-21547383 AATCAGCAGGCCGGGCGCGGAGG - Intergenic
1135878397 16:26227590-26227612 GAGTAGCAGGCCAGGCGCGGTGG - Intergenic
1135959922 16:26986911-26986933 GAGCTCCAGGCCAGGCGCGGTGG + Intergenic
1136164208 16:28441968-28441990 GACAAGCAGGCCGGGCGCGGTGG - Intergenic
1136198756 16:28673015-28673037 GACAAGCAGGCCGGGCGCGGTGG + Intergenic
1136215103 16:28787189-28787211 GACAAGCAGGCCGGGCGCGGTGG + Intergenic
1136243597 16:28959853-28959875 ATGCAGCAGGCCAGGCGCGGTGG - Intronic
1136259826 16:29067039-29067061 GACAAGCAGGCCGGGCGCGGTGG + Intergenic
1136261755 16:29082175-29082197 GGGCCGCAGGCCCGACGCGGAGG - Intergenic
1136339579 16:29633303-29633325 AATCAGCAGGCCGGGCGCGGAGG - Intergenic
1136861570 16:33707311-33707333 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1137259329 16:46811214-46811236 GAGAAGCAGGCCAGGCGCGGTGG + Intronic
1137842916 16:51656518-51656540 GTGCACCAGGCCCGGTGCGGTGG - Intergenic
1138316720 16:56076646-56076668 AAGCAGAAGGCCAGGCGCGGTGG + Intergenic
1138514563 16:57528983-57529005 GGCCAGCAGCGCGGGCGCGGGGG + Exonic
1138604653 16:58081090-58081112 AAACAGCAGGCCGGGCGCGGTGG - Intergenic
1138656842 16:58496281-58496303 GAGCTGCAGCCCCGGAGTTGCGG + Intronic
1139425735 16:66878975-66878997 GGGCAGGAGGCCGGGCGCGGTGG + Intronic
1139549958 16:67667549-67667571 GAGCTGCAGCCCCGGGGTTGGGG + Intronic
1140051472 16:71485160-71485182 GGTCAGCAGGCCAGGCGCGGTGG + Intronic
1141085993 16:81096077-81096099 GACAAGCAGCCCAGGCGGGGAGG + Intronic
1141142164 16:81503682-81503704 GGGCAGAAGGCCAGGCGCGGTGG - Intronic
1141482009 16:84313084-84313106 TAGCAGCAGCGCCGGTGCCGCGG - Exonic
1141489956 16:84366139-84366161 GATCAGCATCCCCGGAGCAGAGG - Intergenic
1141831154 16:86510588-86510610 AAGCAGCAGCCACCGCACGGCGG + Exonic
1142038880 16:87880184-87880206 GTGCAGGAGCCCAGGTGCGGGGG + Intergenic
1142042246 16:87901872-87901894 AATCAGCAGGCCGGGCGCGGAGG - Intronic
1142061391 16:88032090-88032112 GAGAAGCGGGCCAGGCGCGGTGG - Intronic
1142075040 16:88113063-88113085 GCACAGCAGGCCAGGCGCGGTGG - Intronic
1142224416 16:88870606-88870628 GAGCAGCAGCCCCAGCCACGAGG - Intergenic
1203123065 16_KI270728v1_random:1555496-1555518 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1142689086 17:1594110-1594132 AAGCAGGAGGCCGGGCGCGGTGG - Intronic
1142698377 17:1645677-1645699 GAGCAGCAGCCCCAGCCCCATGG + Exonic
1142836927 17:2594046-2594068 CTGCAGCCGCCCGGGCGCGGTGG - Intronic
1142847551 17:2689634-2689656 GAGCAGCAGCACGGGCAGGGTGG + Exonic
1142896577 17:2983043-2983065 GGGCAGCAGCGCCGTCGCTGGGG + Intronic
1142973975 17:3632240-3632262 GACCTGCAGGCCAGGCGCGGTGG - Intronic
1143057503 17:4173305-4173327 GAGCAGCAGGCCAGGCGCCGCGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143232762 17:5371251-5371273 GAGAAACAGCCCAGGCGCAGTGG - Intronic
1143509026 17:7385075-7385097 AAGCCGCAGGCCGGGCGCGGTGG + Intronic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1144353828 17:14425582-14425604 GGGCAGGTGCCCGGGCGCGGTGG + Intergenic
1144506934 17:15839820-15839842 AAGCAGCAGGCCGGGCGCAGTGG - Intergenic
1145062986 17:19744108-19744130 CAGTAGCAGGCCCGGCGCTGTGG + Intronic
1145171114 17:20657733-20657755 AAGCAGCAGGCCGGGCGCGGTGG - Intergenic
1145963546 17:28901465-28901487 GGGCAGCAGGCCCTGCGTGGGGG - Intronic
1146167537 17:30601228-30601250 GAGCAGCAGCCCCTGGGCTACGG + Intergenic
1146186085 17:30725167-30725189 GACCAGCCGGCCGGGCGCGGTGG - Intergenic
1146308410 17:31748455-31748477 GAGAAGAAGGCCAGGCGCGGTGG + Intergenic
1146916803 17:36683037-36683059 GAGCAGCAGCCTCCACCCGGCGG - Intergenic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147008416 17:37423526-37423548 GAGGAGCAGCCTCGGCAAGGTGG - Exonic
1147134300 17:38426253-38426275 AAGCAGTAGGCCAGGCGCGGTGG + Intergenic
1147328965 17:39685188-39685210 TACCAGCAGGCCAGGCGCGGTGG + Intronic
1147340944 17:39753078-39753100 CAGCTCCAGGCCCGGCGCGGTGG - Intergenic
1147395263 17:40137942-40137964 GGGCTCCAGGCCCGGCGCGGTGG + Intergenic
1147457144 17:40544994-40545016 GAGGAGGAGGCCAGGCGCGGTGG + Intergenic
1147740798 17:42670108-42670130 GCGGAGCGGGCCCGGCGCGGCGG - Exonic
1147989807 17:44325700-44325722 GAGCTGCAGCCCGGGCCGGGCGG + Intergenic
1148155294 17:45421189-45421211 GAGCAACAGTCCGGGCGCAGTGG + Intronic
1148317550 17:46716542-46716564 GAGGTGCAGGCCGGGCGCGGTGG - Intronic
1148380523 17:47193553-47193575 GAGCAGTAGGCCAGGCGCAGTGG - Intergenic
1148486585 17:47994958-47994980 GATCAGCACCCCCAGAGCGGGGG + Intergenic
1148880540 17:50722481-50722503 GAGGAGCCGGCCGGGCGCGGTGG - Intronic
1149314023 17:55421951-55421973 GCGCAGGAGCCCCGGGGCGGAGG - Exonic
1149708625 17:58718283-58718305 GAGAAACAGCCCAGGCGCGGTGG - Intronic
1149814101 17:59706475-59706497 AAACTGCAGACCCGGCGCGGTGG - Intronic
1150006422 17:61472028-61472050 CAGCTGCAGGCCGGGCGCGGTGG - Intronic
1150692297 17:67377231-67377253 CAGCAGCGGCCGCGGCGGGGAGG - Intergenic
1150727485 17:67663280-67663302 AAGCAGTAGGCCGGGCGCGGTGG + Intronic
1150805454 17:68315252-68315274 GAGCAGGAGGCCAGGCGTGGTGG + Intronic
1151120642 17:71789037-71789059 TAGCAGCAGCCCAGGCACGGTGG + Intergenic
1151559160 17:74861543-74861565 GCGCCGGAGCCCGGGCGCGGCGG + Intergenic
1151696676 17:75721523-75721545 TAGCGGCAGCCCAGGCGCGGAGG + Exonic
1151801356 17:76381795-76381817 AAGCAGCAGGCCGGGCGCAGTGG - Intronic
1151854436 17:76710881-76710903 GAGCAGAAGGGCCAGCGCGGTGG + Exonic
1151876428 17:76870027-76870049 GAGTGACCGCCCCGGCGCGGGGG + Intronic
1152364119 17:79845110-79845132 AAGCAGCAGCCCGGCCGCCGTGG - Intergenic
1152521633 17:80859930-80859952 GAGCTCCAGACCCGGCGCAGGGG - Intronic
1152908502 17:82983737-82983759 GGGCAGGGGCCCCGGGGCGGAGG + Intronic
1152923834 17:83078968-83078990 CGGCAGAGGCCCCGGCGCGGCGG + Intergenic
1152979551 18:263364-263386 CAGCTGCAGGCCGGGCGCGGTGG - Intronic
1153234652 18:2974364-2974386 CAGTAGAAGCCCAGGCGCGGTGG - Intronic
1153800087 18:8661125-8661147 GATCAGCCGCCCCGGAGGGGAGG + Intergenic
1154970581 18:21404619-21404641 GAGCACCAGCCCAGGCCCTGAGG + Intronic
1156345482 18:36253378-36253400 GAGTAGGAGGCCAGGCGCGGTGG + Intronic
1156495853 18:37524805-37524827 GAGCCGCGGCCGGGGCGCGGAGG - Intronic
1156537843 18:37880904-37880926 GAGGAGCAGGCCGGGTGCGGTGG - Intergenic
1157424539 18:47573530-47573552 TAGCTGCAGGCCGGGCGCGGTGG + Intergenic
1158579858 18:58671687-58671709 GAGCAGCGGCCCCGTGGGGGCGG - Exonic
1159798226 18:72868205-72868227 GCGCACCAGCCCCGGGGCGCCGG - Intergenic
1160512105 18:79458446-79458468 CAGCATCAGCACCGGCGTGGGGG + Intronic
1160513267 18:79464380-79464402 AAACAGCAGGCCGGGCGCGGTGG - Intronic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160731973 19:645313-645335 GGTCAGCAGGCCGGGCGCGGGGG + Intergenic
1160759838 19:778025-778047 GAGCTGCAGGCCGGGGGCGGTGG + Intergenic
1160919547 19:1513285-1513307 GAATAGCAGCCCCGGGGCAGAGG - Intronic
1160993516 19:1871475-1871497 GAGCGCCAGCCCCGGGGGGGTGG - Intergenic
1161154760 19:2726881-2726903 GAGCTGCAGCCCTGGCTCTGGGG - Intronic
1161278594 19:3433250-3433272 GAACAGCAGGCCGGGCGCAGTGG - Intronic
1161325747 19:3663151-3663173 CAGCAGCCGGCCGGGCGCGGAGG - Intronic
1161677604 19:5661206-5661228 AAGCAACAGGCCGGGCGCGGTGG - Intronic
1161973243 19:7595708-7595730 GAGCAGCAGGGGCGGGGCGGAGG - Intergenic
1162724764 19:12683393-12683415 TAGCAGCAGGCCAGGCGCGGTGG - Intergenic
1162758484 19:12874423-12874445 GCGCAGCAGCTCTGGCGAGGCGG + Exonic
1162954669 19:14091231-14091253 GCGCGGCAGCCCCGGCCCGCGGG - Intergenic
1163313047 19:16525460-16525482 GAGCAGCCGCCCTGGGGCGGGGG - Exonic
1163569851 19:18074762-18074784 TAGCAGTAGGCCGGGCGCGGTGG + Intronic
1163604793 19:18268083-18268105 GAAAAGCAGGCCGGGCGCGGTGG - Intronic
1163642599 19:18470027-18470049 AAGCAGCTGGCCAGGCGCGGTGG + Intronic
1164613407 19:29649026-29649048 AAGCACAAGGCCCGGCGCGGTGG - Intergenic
1165097093 19:33415382-33415404 GAGCGGCAGGCCGGGCGCAGTGG + Intronic
1165481888 19:36069185-36069207 CAGCAGCCGCCCCGTCCCGGAGG - Intronic
1165959960 19:39525619-39525641 AAGCAGCAGGGCGGGCGCGGTGG + Intergenic
1166126336 19:40717269-40717291 GCGCAGGGGCCCCGGCGGGGCGG + Exonic
1166146218 19:40837784-40837806 GAGTAACAGGCCGGGCGCGGTGG + Intronic
1166731831 19:45063735-45063757 GATGAGCAGGCCGGGCGCGGTGG - Intronic
1166748570 19:45153804-45153826 GAGCCGCAGACCCGCCGGGGTGG + Intronic
1167441877 19:49513423-49513445 GAGCAGGAGCCCCAGCGCCCAGG - Exonic
1167495713 19:49817634-49817656 GGGCAGCGGGCCCGGCGCGGTGG + Intergenic
1167709005 19:51098785-51098807 GAGCAGGCGCCGGGGCGCGGGGG + Exonic
1168059276 19:53882310-53882332 GAGCGGCACCCCGGGCGCGCCGG - Exonic
1168074539 19:53972647-53972669 GCACAGAAGCCCAGGCGCGGTGG - Intronic
1168100472 19:54138470-54138492 AGGGAGAAGCCCCGGCGCGGAGG - Intronic
1168318895 19:55497046-55497068 GAGCAGCAGGCCCGGCACGGTGG - Intronic
925070894 2:965634-965656 CAGCAGCAGCCCCCGAGCCGAGG - Intronic
925349230 2:3189535-3189557 GCGCAGCAGCTCCGGCGGGGCGG + Intronic
925731598 2:6922909-6922931 AAGCAGGAGGCCGGGCGCGGTGG - Intronic
925929086 2:8693448-8693470 GAGCAGCCGCAGCGGGGCGGCGG + Intergenic
926279628 2:11435210-11435232 GCGCAGCACCCACGGTGCGGTGG - Intergenic
927947674 2:27146916-27146938 GTGCATCAGGCCGGGCGCGGTGG - Intergenic
928169016 2:28991600-28991622 GAGCGGCAGCCCCAGGGCTGTGG + Intronic
928579396 2:32691584-32691606 GAGATGCAGGCCAGGCGCGGTGG - Intronic
928681813 2:33710581-33710603 GAGAAGCAGGCCGGGCACGGTGG + Intergenic
928951249 2:36815052-36815074 GGGCAGTAGACCAGGCGCGGGGG + Intergenic
928964901 2:36966578-36966600 GAGCAGCCTCCTGGGCGCGGGGG + Intergenic
929484897 2:42344563-42344585 GCGTCGCAGGCCCGGCGCGGTGG + Intronic
929534192 2:42770334-42770356 GAGCAGCAGCCCCGCTGGGAGGG - Intronic
929604177 2:43224534-43224556 GTGCGGCGGCCCCGGCGGGGAGG + Exonic
930714081 2:54576339-54576361 GAGCTGAAGGCCGGGCGCGGTGG - Intronic
930721915 2:54646271-54646293 CAGCAGCAGCCTCAGCGCTGAGG + Exonic
932058205 2:68467747-68467769 GAGCTGCAGCCGCGGGACGGCGG + Exonic
932217332 2:69975397-69975419 GAGGAGCAGCACCGGCAGGGAGG - Intergenic
933087342 2:78072245-78072267 GAAAAGCAGGCCAGGCGCGGTGG + Intergenic
933385912 2:81609903-81609925 CAGAAGCAGGCCGGGCGCGGTGG - Intergenic
933684764 2:85133912-85133934 GAGCAGCAGCTCGGACTCGGAGG + Exonic
934989431 2:98911112-98911134 GAGCAGGAGCACGGGCGTGGGGG - Intronic
935544782 2:104389440-104389462 GAGAAGGAGCCCAGGCGCTGTGG + Intergenic
935872211 2:107463434-107463456 CAGAAGCAGGCCGGGCGCGGTGG + Intergenic
936161136 2:110084975-110084997 GAGAATCAGGCCGGGCGCGGTGG + Exonic
936183527 2:110286379-110286401 GAGAATCAGGCCGGGCGCGGTGG - Intergenic
938079944 2:128364582-128364604 GAGCAGCTCCCTCGGCGTGGGGG + Intergenic
938375363 2:130801826-130801848 GTACAGCAGGCCGGGCGCGGTGG + Intergenic
938574435 2:132590962-132590984 GAGGAACAGGCCGGGCGCGGTGG + Intronic
940226667 2:151408530-151408552 GAGAAGCAGACCGGGCGCGGTGG + Intergenic
940542204 2:155034969-155034991 TAACAGCAGGCCGGGCGCGGTGG - Intergenic
941104944 2:161341261-161341283 GAGCAGAAGGGCCAGCGCGGTGG + Intronic
941110748 2:161416991-161417013 GGGCACCAGCCCCGGCTGGGTGG - Exonic
941113488 2:161444517-161444539 GAAAAGCAGGCCCGGCACGGTGG - Intronic
941819047 2:169827026-169827048 GAACAGAAGGCCAGGCGCGGTGG - Intergenic
941922693 2:170867704-170867726 GAACAGCAGGCCTGGCGCGGGGG - Intergenic
941951299 2:171160191-171160213 GCGGAGAAGCCCCGGGGCGGGGG + Intronic
942046558 2:172102441-172102463 CACCAGCAGCCCCCGAGCGGCGG - Exonic
942145737 2:173024502-173024524 CTGCAGCAGGCCGGGCGCGGTGG - Intronic
942241060 2:173964551-173964573 GAGCTGCAGGCACAGCGCGGGGG + Exonic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
944092621 2:195930055-195930077 GAGCAGCAGGCCAGGTGCGCTGG + Intronic
944468441 2:200027400-200027422 CAGCAGCAGGCCAGGCACGGGGG + Intergenic
944717822 2:202392703-202392725 GAGCATCTGGCCGGGCGCGGTGG + Intronic
944759582 2:202800166-202800188 AAGCAGCAGGCCAGGCGCGGTGG - Intronic
944858789 2:203794287-203794309 AAGCAGTAGGCCGGGCGCGGTGG + Intergenic
946139889 2:217681428-217681450 CAGCACCAGGCCGGGCGCGGTGG + Intronic
947386336 2:229594299-229594321 GAGCAGAGGGCCGGGCGCGGTGG + Intronic
947505421 2:230704793-230704815 GAAAAGCAGGCCAGGCGCGGTGG - Intergenic
947506183 2:230710136-230710158 GAGGAGAAGTCCTGGCGCGGTGG - Intergenic
947854816 2:233315985-233316007 CAGCAGCAGCCCGGGCGCGGTGG - Intronic
948165633 2:235859817-235859839 GAGGAGCAGCTCCAGGGCGGAGG - Intronic
948725638 2:239932119-239932141 GAGGTGCAGGCCGGGCGCGGTGG - Intronic
948893248 2:240917011-240917033 GAGCAGCAGCCCAGTGGGGGAGG - Intergenic
948977763 2:241474017-241474039 GAGCTGCAGGCCGGGCGCGGTGG + Intronic
1169033847 20:2433700-2433722 GACCAGCCGGCCAGGCGCGGTGG + Intergenic
1169137224 20:3204449-3204471 GCGCAGGAGCCGCGGCGCGACGG + Intronic
1170095574 20:12642407-12642429 AAGCAGCAGCCCTGGCACGATGG - Intergenic
1170225012 20:13982737-13982759 CAGCAGCAGGCCAGGCACGGTGG + Intronic
1171030295 20:21670499-21670521 CAGCTGCAGGCCGGGCGCGGTGG + Intergenic
1171484263 20:25476283-25476305 GAGCAGCAGGCCCGGGCCGAGGG - Exonic
1171823143 20:29873970-29873992 GACCAGCGGCCCCGGGGTGGCGG + Intergenic
1171973930 20:31581810-31581832 GAGCAAAAGGCCGGGCGCGGTGG + Intergenic
1172115988 20:32573984-32574006 GAGCAGCAGCCCCTATGCTGTGG + Intronic
1172284642 20:33732136-33732158 GCGCAGCGGCCGCGGGGCGGAGG + Intronic
1172385012 20:34528023-34528045 GAGTAGCCGGCCGGGCGCGGTGG + Intronic
1172563673 20:35911327-35911349 GAACAGCAGGCCGGGCGCAGTGG - Intronic
1172609166 20:36236610-36236632 AACCAGCCGCCCCGGCGAGGTGG - Exonic
1172969880 20:38865576-38865598 ATGCAGCAGGCCGGGCGCGGCGG - Intronic
1173947953 20:46966519-46966541 AAACAGCAGGCCTGGCGCGGTGG + Intronic
1173979255 20:47210605-47210627 GTGTAGCAGCCCCCGCGCCGGGG + Exonic
1175160024 20:57001496-57001518 GAGCAGCAGCCTCGGCACCACGG + Intergenic
1175466249 20:59192634-59192656 GAGCGGCAGCCCAGGCGGGCTGG - Exonic
1175678294 20:60965977-60965999 GTGCAGGAGGCCGGGCGCGGTGG - Intergenic
1175984904 20:62759791-62759813 CAGCAGCAGCCCAGGCTGGGCGG + Intronic
1176152677 20:63600428-63600450 CTGCAGCAGGCCGGGCGCGGTGG + Intronic
1176870394 21:14079169-14079191 AAGCAGCAGGCTGGGCGCGGCGG + Intergenic
1176931697 21:14819898-14819920 AAGCAGCAGGCCGGGCGCGGCGG - Intergenic
1177819062 21:26011361-26011383 GAACAGAAGCCCAGGCGTGGTGG - Intronic
1178493808 21:33070788-33070810 CAGCAGCAGGCGCGGCGCGGCGG - Exonic
1178707802 21:34889395-34889417 GAGCCGCGGCCCGGGCGCAGCGG - Intronic
1178869907 21:36364762-36364784 GTGAAGCAGCCCGGGCGCGGTGG + Intronic
1179225092 21:39445852-39445874 CAGCAGGAGCCGCGGCGGGGAGG + Intronic
1179547958 21:42124983-42125005 GAGAAGCAGCCCCGTCCCTGTGG + Intronic
1179960045 21:44762970-44762992 GCGGAGCAGCCCAGGCGCGAGGG + Intergenic
1180231195 21:46427712-46427734 GAGCTGCAGCCCCGACTCAGTGG + Exonic
1180704523 22:17800981-17801003 AAGCAGCAGCCCCCACGTGGTGG + Intronic
1180736296 22:18020098-18020120 CAGCAGCTGGCCGGGCGCGGTGG - Intronic
1180965473 22:19786018-19786040 GAGCAGCAGAACCGGTGCTGGGG - Exonic
1181129641 22:20723305-20723327 GAACAGTAGGCCGGGCGCGGTGG - Intronic
1182558217 22:31140449-31140471 GCCCAGCAGGCCCGGTGCGGCGG + Exonic
1183219971 22:36506319-36506341 ACGCAGTAGTCCCGGCGCGGGGG + Exonic
1183639177 22:39082936-39082958 GAGGAGCAGCCCGGGAGTGGGGG - Intronic
1183641146 22:39093293-39093315 GAGCAACAGGCAGGGCGCGGTGG + Intergenic
1183720326 22:39558399-39558421 GAGCCGCAGCCGCGGAGGGGCGG - Intergenic
1184147875 22:42622205-42622227 AAGGAGCAGGCCGGGCGCGGTGG - Intronic
1184481815 22:44752579-44752601 GAGCGGCAGACCCGGCACGCAGG + Exonic
1184747576 22:46465170-46465192 GAGCAGCGGCCCCTGCCCAGGGG + Intronic
1185139634 22:49093072-49093094 GAGGATTAGCCCCGGCACGGAGG + Intergenic
1185379444 22:50501354-50501376 GAACATCAGGCCGGGCGCGGTGG + Intergenic
1185395222 22:50583218-50583240 CAGCTGCAGCTCCGGCGCGAGGG + Intronic
949229821 3:1737361-1737383 GAACAACAGGCCGGGCGCGGTGG - Intergenic
950722389 3:14892528-14892550 GTCCAGCAGGCCGGGCGCGGTGG + Intronic
950787126 3:15446225-15446247 GAACAGCAGGCCGGGCACGGTGG + Intronic
950789934 3:15463631-15463653 GAGGAGTAGGCCAGGCGCGGTGG - Intronic
953636795 3:44671101-44671123 GAGGAGCAGCCCCGGGCCAGTGG + Intergenic
955291026 3:57692725-57692747 CTGCAGCCGCCCCGGCGCAGGGG + Intronic
955997853 3:64696275-64696297 AAGCAGCCGGCCGGGCGCGGTGG + Intergenic
957471127 3:80658664-80658686 GATCAGCCGGCCGGGCGCGGTGG + Intergenic
958430833 3:94038806-94038828 GAGCAGCCGGCCGGGTGCGGTGG - Intronic
958883879 3:99704575-99704597 GAGCAGCAGCCCCTGCTCTTTGG + Intronic
960046989 3:113208705-113208727 GAGCAGCAGGCCGGGAGCAGTGG + Intergenic
961158147 3:124698261-124698283 GAGCAGGAGGCCGGGCGCGGTGG - Intronic
963120630 3:141773699-141773721 GACCATCAGGCCGGGCGCGGTGG - Intergenic
964071103 3:152634350-152634372 CAGCATCAGGCCGGGCGCGGTGG - Intergenic
965392377 3:168120401-168120423 GAGCAGCCGGCCAGGCGCGGTGG - Intergenic
966199377 3:177345735-177345757 AAGCAGCAGCCCTGGAGCGCTGG - Intergenic
967735959 3:192952837-192952859 CAGCAGCAGGCCGGGCGCGGTGG + Intergenic
968084747 3:195869301-195869323 GAGCAGAAGCCCAGGCTCCGGGG + Intronic
968092921 3:195909419-195909441 GAGCAGCAGCCGCAGCGCGTAGG - Intronic
968202171 3:196764087-196764109 CAGCAGCAGGCCGGGCGCGGTGG - Intronic
968499350 4:940159-940181 GAGCAGTAGGCCAGGCGCAGTGG + Intronic
968703620 4:2067950-2067972 GCACAGCAGCCGTGGCGCGGAGG - Exonic
968756131 4:2417516-2417538 GGCCAGCAGCCTCGGCGGGGCGG - Intronic
969298056 4:6281142-6281164 GAGCAGGAGCCCTGGGGAGGAGG + Intronic
969556527 4:7915168-7915190 GAGCAGCTGGCTGGGCGCGGGGG - Intronic
969569114 4:7998171-7998193 CAGCAGAAGGCCCGGCGCAGTGG - Intronic
969591620 4:8125590-8125612 CAGAAGCAGCCCCGGCACCGAGG - Intronic
970028976 4:11655603-11655625 CAGCAGCAGCCACTGCACGGAGG + Intergenic
970382555 4:15522829-15522851 GAAAAGCAGGCCCGGCGCAGTGG + Intronic
972076197 4:35090982-35091004 GAGAAACAGGCCGGGCGCGGTGG + Intergenic
975661069 4:76689517-76689539 CAGCTGTAGCCGCGGCGCGGTGG + Intronic
976417707 4:84797856-84797878 GGGAAACAGGCCCGGCGCGGTGG - Intronic
978795766 4:112706061-112706083 GGGCCGCAGGCCCGACGCGGAGG + Intergenic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
979594699 4:122521742-122521764 AAGCATCAGGCCAGGCGCGGTGG + Intergenic
979933021 4:126655923-126655945 GAACAGGAGGCCAGGCGCGGTGG - Intergenic
980125679 4:128771698-128771720 GAGTAGAAGGCCGGGCGCGGTGG + Intergenic
980407960 4:132378780-132378802 GAGGAGCAGGCCAGGCACGGTGG + Intergenic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
981942227 4:150294662-150294684 TAGCAGCAGGCCAGGCGCAGTGG + Intronic
983912041 4:173250733-173250755 GTGCAGCAGCCCCCACGCTGTGG + Intronic
984115164 4:175671148-175671170 AAGCAGCAGGCCGGGCGTGGTGG - Intronic
984167524 4:176320285-176320307 GCACGGCAGCCCCGGCGCGGCGG - Intronic
984250058 4:177320752-177320774 TGACAGCAGGCCCGGCGCGGTGG - Intronic
984698229 4:182800157-182800179 GAGCAGCAGCGCGTGCGCGACGG + Exonic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985068438 4:186144968-186144990 GAGCCCCAGCCCCGGGGCCGCGG + Exonic
986152194 5:5138952-5138974 GAGCAGTAGGCCGGGCGCGGTGG - Intergenic
986268622 5:6211910-6211932 GAGTTGCAGCCCCGGCGGTGGGG + Intergenic
986407865 5:7444400-7444422 TAAAAACAGCCCCGGCGCGGTGG - Intronic
986504269 5:8432512-8432534 TAGCAACAGGCCGGGCGCGGTGG + Intergenic
987756846 5:22107416-22107438 GAGCAGAAGGCCCAGCACGGTGG - Intronic
988521803 5:31952770-31952792 GAATAGCAGCCCAGGCACGGTGG + Intronic
988796470 5:34656906-34656928 GCTCAGCAGCACCGACGCGGGGG - Intronic
989753712 5:44925613-44925635 GAGAAGGAGGCCGGGCGCGGTGG - Intergenic
990557549 5:56951604-56951626 GCGCCGCAGCCCGGGCCCGGTGG + Intronic
990561934 5:56992069-56992091 GAGCTTCAGGCCGGGCGCGGTGG - Intergenic
990592680 5:57282282-57282304 GAGTAGCACACCAGGCGCGGTGG + Intergenic
990707569 5:58547105-58547127 TAGAAACAGGCCCGGCGCGGTGG + Intronic
991327985 5:65459163-65459185 GAGAAACAGGCCGGGCGCGGTGG - Intronic
991362736 5:65837767-65837789 GGGCAACAGGCCGGGCGCGGTGG - Intronic
992320807 5:75611669-75611691 GAGCAGCAGCCCCCCTGCCGTGG - Exonic
992544278 5:77795088-77795110 GAGCAGCCGCCCCGTCTGGGAGG - Intronic
992620218 5:78585292-78585314 GCGCACCAGGCCGGGCGCGGTGG - Intronic
992680514 5:79148312-79148334 GAGCAGCAGACCAGGTGCGGTGG - Intronic
992953736 5:81886989-81887011 GAAAAGCAGGCCGGGCGCGGTGG - Intergenic
995918748 5:117284460-117284482 GAGAAGCAGGCCGGGCACGGTGG - Intergenic
996831439 5:127744454-127744476 CAGCAGCAGCCCCTGCTCAGTGG - Intergenic
998345964 5:141463731-141463753 GAGAAGCAGGCCGGGCGCGGTGG - Intronic
998481283 5:142465277-142465299 GAAAAGCAGGCCCGGCGTGGTGG + Intergenic
998488364 5:142523605-142523627 CACCAGCAGGCCGGGCGCGGTGG - Intergenic
1000057432 5:157619674-157619696 GAACAGCAGGTCCGGCACGGTGG - Intergenic
1000336725 5:160246794-160246816 GAGCAGCAGGCCAGGCACTGTGG + Intergenic
1000922221 5:167151802-167151824 GAAAAGCAGGCCAGGCGCGGTGG - Intergenic
1001630031 5:173168207-173168229 GAGCACCAGCCACAGGGCGGTGG - Intergenic
1001711374 5:173781149-173781171 CAGCAGCAGGCCGGGAGCGGTGG + Intergenic
1001997716 5:176175256-176175278 CAGCAAAAGCCCCGGGGCGGAGG + Intergenic
1002098983 5:176848097-176848119 GACCAGCAGCCCCCACGCTGCGG + Intronic
1002801686 6:529121-529143 GAGCAGTAACCAGGGCGCGGGGG - Intronic
1003986912 6:11444404-11444426 GCGTAGCAGGCCGGGCGCGGTGG - Intergenic
1005725340 6:28642297-28642319 AAACAGCAGGCCGGGCGCGGTGG + Intergenic
1005751522 6:28887124-28887146 AAGAAGCAGGCCAGGCGCGGTGG + Intergenic
1005851712 6:29827936-29827958 GGGAAACAGCCCCTGCGCGGAGG + Intronic
1005923190 6:30418441-30418463 AAGCAGCAGCCCTGGGGTGGAGG + Intergenic
1005943174 6:30576574-30576596 GAGCACCCGGCCGGGCGCGGTGG - Intronic
1006175394 6:32118303-32118325 GAGCAGGAGGCCGGGCGAGGTGG + Intronic
1006304120 6:33208647-33208669 GAGGGGCAGTGCCGGCGCGGGGG + Intronic
1006647293 6:35523431-35523453 GAGCACCTGGCCGGGCGCGGTGG + Intergenic
1006863321 6:37188237-37188259 AAACAGCAGGCCGGGCGCGGTGG + Intergenic
1007363220 6:41373206-41373228 CACCCGCAGCTCCGGCGCGGGGG - Intergenic
1007629068 6:43262814-43262836 GAGGAGCAGGCCTGGCGCGAGGG - Exonic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1009954002 6:70430047-70430069 GAGCAGAAGGCCGGGTGCGGTGG + Intronic
1010199571 6:73270975-73270997 GAGCAACAGGCCGGGCGCGGTGG - Intronic
1011749316 6:90439266-90439288 AAGCAGGAGGCCAGGCGCGGTGG - Intergenic
1011853734 6:91663035-91663057 GTGCAGCAGGCCGGGCACGGTGG - Intergenic
1012475819 6:99613906-99613928 GAGGGGCAACCCCGGCGCAGGGG - Exonic
1013314027 6:108924228-108924250 GAGCAGGAGGCCGGGCGCGGTGG + Intronic
1013353476 6:109327006-109327028 CAGCAGCTGGCCAGGCGCGGTGG - Intergenic
1013472361 6:110476645-110476667 GAGCAGGAGGCCGGGCGGGGAGG - Intergenic
1015339307 6:132079620-132079642 GTGCTGCAGGCCGGGCGCGGTGG + Intergenic
1015563107 6:134537647-134537669 GAGTAACAGGCCAGGCGCGGTGG + Intergenic
1016104106 6:140140529-140140551 GTGCAGTAGGCCGGGCGCGGTGG + Intergenic
1016493520 6:144633517-144633539 GAGAAGCAGGCCGGGCGCGGTGG - Intronic
1016848444 6:148592421-148592443 GAGCACCAGGCCAGGCGTGGTGG - Intergenic
1017163850 6:151390519-151390541 GCGCAACAGCCCCGGCGCCGGGG + Intronic
1018470906 6:164097043-164097065 CAGCAACAGGCCGGGCGCGGTGG - Intergenic
1018682568 6:166275890-166275912 CACCAGCAGCCCGGGCGAGGCGG - Intergenic
1018858981 6:167697580-167697602 GAGCTGCAGCCTCAGGGCGGTGG + Intergenic
1019049905 6:169174955-169174977 GAGCAGCAGGGCAGGGGCGGTGG - Intergenic
1019088294 6:169502081-169502103 GGGCAGCCGCCCCGGGGCTGCGG + Intronic
1019147614 6:169985061-169985083 TAGCAGTGGCCCCGGCGCTGAGG - Intergenic
1019293346 7:261085-261107 GGGCAGCTGCCCCGGGGCTGTGG + Intergenic
1019325397 7:435987-436009 GAACAGCAGCCCCGCCCCGTTGG + Intergenic
1020186757 7:5964899-5964921 CAGCTGCAGGCCAGGCGCGGTGG - Intronic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020296159 7:6759875-6759897 CAGCTGCAGGCCAGGCGCGGTGG + Intronic
1021203466 7:17752663-17752685 GAGGAGCAGGCCGGGTGCGGTGG + Intergenic
1021917755 7:25452939-25452961 GACAAGAAGCCCCAGCGCGGTGG + Intergenic
1022450332 7:30507878-30507900 CAGCAGTAGGCCAGGCGCGGTGG - Intronic
1022459902 7:30595077-30595099 GAGCAGCATGGACGGCGCGGGGG + Exonic
1022468633 7:30668020-30668042 CAGCAGCAGCCCGAGGGCGGTGG - Intronic
1022561853 7:31357910-31357932 GAGCAGCAGCCACGGTGAGCCGG - Intergenic
1023096925 7:36670760-36670782 GACCAGCGGGCCGGGCGCGGTGG - Intronic
1023838446 7:44082030-44082052 AAGCAGTAGGCCGGGCGCGGTGG - Intronic
1023865057 7:44234560-44234582 GAGCAGGAGCCCCAGGGCGTGGG + Intronic
1024674306 7:51624206-51624228 GAGGAGCTGGCCGGGCGCGGTGG + Intergenic
1025981680 7:66412360-66412382 GAGCAGAAGGCCAGGCGTGGTGG - Intronic
1026154188 7:67812901-67812923 GAGCAGGAGGCTGGGCGCGGTGG - Intergenic
1026171470 7:67957703-67957725 GAACAGCAGGCCAGGCACGGTGG + Intergenic
1027187455 7:75980768-75980790 GAGCTGGAGCCCCAGCCCGGTGG + Intronic
1027208175 7:76120476-76120498 GAGCAATAGGCCGGGCGCGGTGG + Intergenic
1027260524 7:76461777-76461799 GAGCTGCAGCCCGAGCGCGGTGG + Exonic
1027311901 7:76959890-76959912 GAGCTGCAGCCCGAGCGCGGTGG + Intergenic
1027422149 7:78027338-78027360 GACCTGCAGGCCAGGCGCGGTGG + Intronic
1028959334 7:96731715-96731737 GAAAAGCAGGCCGGGCGCGGTGG + Intergenic
1029271942 7:99382148-99382170 GAGCACCTGGCCAGGCGCGGTGG + Intronic
1029512658 7:101006083-101006105 CAGAAGGAGGCCCGGCGCGGTGG - Intronic
1029567125 7:101346442-101346464 GAGCATGAGGCCAGGCGCGGTGG + Intergenic
1029588654 7:101492407-101492429 GAGTTGCAGGCCGGGCGCGGTGG + Intronic
1029996275 7:105011868-105011890 AAAAAGCAGGCCCGGCGCGGTGG + Intergenic
1032095755 7:128937900-128937922 CAGCAGCTGCCCAGGGGCGGGGG + Intronic
1032201712 7:129826662-129826684 GAGAAGCAGGCCTGGCGCGGTGG - Intergenic
1033122340 7:138677189-138677211 GAGCAGGAGGCCGGGCGCAGTGG - Intronic
1033162083 7:139006667-139006689 GAGTTGCAGGCCGGGCGCGGTGG - Intergenic
1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG + Intronic
1033332573 7:140428633-140428655 GAGCAGCAGGCCAGGTGCAGTGG - Intergenic
1033360176 7:140633440-140633462 GAGCATTAGGCCAGGCGCGGTGG - Intronic
1034284318 7:149874230-149874252 AAGCCGCCGCCCCGGGGCGGAGG - Intronic
1034448083 7:151123508-151123530 GAGGAGCACGCCCGGGGCGGGGG - Intronic
1034895865 7:154875969-154875991 GGTGAGCAGCCACGGCGCGGTGG + Exonic
1035100089 7:156389309-156389331 GGGCAGCAGCCCCGGTGCTCTGG + Intergenic
1035165218 7:156985425-156985447 GAGCAGGAGCCCTGGGGCGGAGG + Intergenic
1035266028 7:157690769-157690791 CAGCAGCAGCGGCTGCGCGGCGG + Intronic
1035429306 7:158806046-158806068 TAGCAGCAGAGCCGGCGCCGGGG + Intronic
1036589085 8:10151354-10151376 GAACAGCAGGCCGGGCGTGGTGG + Intronic
1038749368 8:30281691-30281713 GAAAAGCAGGCCGGGCGCGGTGG + Intergenic
1039484093 8:37898221-37898243 GCGCCCCAGGCCCGGCGCGGTGG + Intronic
1039873614 8:41567407-41567429 GCGCAGCAGCCCGGGCGTGGGGG - Intergenic
1039967968 8:42297605-42297627 GAGCAGATGGCCAGGCGCGGTGG + Intronic
1040054050 8:43042072-43042094 GAGCAAGAGGCCGGGCGCGGTGG + Intronic
1040495175 8:47959973-47959995 GAGCAGCAGCCCCGCGGTGCTGG - Exonic
1041109403 8:54470521-54470543 CGTCAGCTGCCCCGGCGCGGCGG - Intergenic
1041269748 8:56099787-56099809 GGGCAGCAGCCCAGGCATGGTGG - Intergenic
1041926077 8:63237651-63237673 GAACAACAGCCCGGGCACGGTGG - Intergenic
1042221438 8:66478372-66478394 AAGCAGCAGGCCGGGCGCAGTGG - Intronic
1043502783 8:80873784-80873806 AAGCAGCAGCACCGGCGACGAGG + Intronic
1044637330 8:94340386-94340408 GAGCTGCAGGCCAGGCGCGGTGG + Intergenic
1045510714 8:102810436-102810458 GCGGAGCGGCCCGGGCGCGGCGG + Intergenic
1045583223 8:103500814-103500836 CAGCGGCGGCACCGGCGCGGCGG - Intronic
1047800594 8:128305804-128305826 GAGCAACAGGCCAAGCGCGGTGG + Intergenic
1049058034 8:140254376-140254398 GAGCAGCTGCCCAGGGGCTGGGG - Intronic
1049406254 8:142452965-142452987 GAGCCGCGGGCCAGGCGCGGAGG - Intronic
1049620940 8:143598013-143598035 GGGCCGCGGCCCGGGCGCGGGGG - Exonic
1049658818 8:143810624-143810646 GAGCAGCAGCCACAGGGCAGGGG + Intronic
1049663943 8:143834840-143834862 GAGCAGCTGCCCCAGGGAGGAGG + Exonic
1049676155 8:143890168-143890190 GAGTAGCTGCCCTGGCGTGGCGG - Intergenic
1050523691 9:6527496-6527518 GAGCAGCAGCCCCTGAGAGTAGG - Intergenic
1050786794 9:9413399-9413421 AAGCTGCAGGCCGGGCGCGGTGG - Intronic
1051235368 9:14993364-14993386 GAAGCGCAGGCCCGGCGCGGGGG + Intergenic
1052871443 9:33511189-33511211 GAGGCGCCGCCGCGGCGCGGAGG + Intergenic
1055354589 9:75424833-75424855 CAGCAGCAGCGCCGGCACAGGGG + Intergenic
1056046691 9:82725740-82725762 AAGAAGCAGACCAGGCGCGGTGG + Intergenic
1056176470 9:84041488-84041510 GAACAGGAGGCCGGGCGCGGTGG + Intergenic
1056475094 9:86945881-86945903 GCGCCGCTGCCCGGGCGCGGTGG + Exonic
1056962105 9:91134419-91134441 CAACAGCAGGCCGGGCGCGGTGG - Intergenic
1059021307 9:110579557-110579579 GAGCGGCTGCCCCGGAGCGCAGG + Exonic
1059186744 9:112280340-112280362 AAACAGCAGCCCAGGCACGGTGG - Intronic
1060205219 9:121678827-121678849 GAGCAGCACCCCGGGCGAGGTGG - Intronic
1060623009 9:125084455-125084477 CAGCAGCCGGCCGGGCGCGGTGG - Intronic
1061087780 9:128409321-128409343 GGGCCGGAGCCCCGGCGAGGCGG - Intergenic
1061347270 9:130036756-130036778 GAGCAGTAGGCCGGGCGCAGTGG + Intronic
1061385262 9:130285797-130285819 GAGAAGCAGTCCCGGCCCTGTGG - Intronic
1061486308 9:130922234-130922256 TGGCAGCAGCCCTGGGGCGGTGG + Intronic
1061780102 9:132990807-132990829 GAGCAGCAGGCCTGGTGAGGAGG + Intronic
1061955673 9:133960093-133960115 GAGCGGTAGCCCCGGGGCAGGGG - Intronic
1061978896 9:134088442-134088464 GAGCTGCAGCCCCGGGGCCAAGG - Intergenic
1062352714 9:136147156-136147178 AAGCAGCAGCACCGGCGCACAGG + Intergenic
1062550590 9:137084459-137084481 CAGCAACCGGCCCGGCGCGGTGG - Exonic
1185610834 X:1392815-1392837 AACCCCCAGCCCCGGCGCGGAGG - Intergenic
1185735866 X:2495752-2495774 GTGCAGCATCCCCAGTGCGGGGG + Intronic
1186477058 X:9865845-9865867 CAGCAGGAGGCCAGGCGCGGTGG - Intronic
1187503656 X:19861087-19861109 AAACAGCAGGCCAGGCGCGGTGG + Intronic
1187878183 X:23821589-23821611 GAGCAGAGGGCCAGGCGCGGTGG - Intergenic
1187907773 X:24083576-24083598 TAGCAGGAGGCCAGGCGCGGTGG + Intergenic
1188257777 X:27983017-27983039 GAACAACAGGCCGGGCGCGGTGG - Intergenic
1188390017 X:29608537-29608559 GAGGAGGAGGCCGGGCGCGGTGG + Intronic
1189324043 X:40102461-40102483 GAGCACCCGGCCCAGCGCGGCGG - Intronic
1190035555 X:47020041-47020063 GAGTATCAGGCCGGGCGCGGTGG + Intronic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1192118597 X:68433946-68433968 GAGCAGCCTCCCAGGCGGGGTGG - Intergenic
1192140619 X:68644692-68644714 AAGGAACAGGCCCGGCGCGGTGG - Intergenic
1194683548 X:96883665-96883687 GAGCATCAGGCCGGGCGCAGTGG - Intronic
1194873548 X:99161316-99161338 CAGCAGCAGCCACTGCACGGAGG + Intergenic
1197210141 X:123821530-123821552 CAGCATCAGGCCGGGCGCGGTGG - Intergenic
1197981018 X:132217996-132218018 GAGCAGCAGCGCTGGGGCAGCGG - Exonic
1198148344 X:133881970-133881992 GAGCAGGAGGCACGGCGCGAAGG - Intronic
1198393545 X:136200874-136200896 GAGCAGGAGGCCGGGCACGGTGG + Intronic
1199320053 X:146427362-146427384 GAGGAGGAGGCCGGGCGCGGTGG - Intergenic
1199527883 X:148812394-148812416 GAGCACTAGCCCCGGAGTGGAGG + Intronic
1199741802 X:150742527-150742549 GCTCAGCAGGCCAGGCGCGGTGG + Intronic
1199792333 X:151167096-151167118 GAGCAGCTGGCCAGGCGCGGTGG + Intergenic
1199858832 X:151781451-151781473 GAGCTGCTGGCCCGGCGAGGTGG - Intergenic
1201546536 Y:15169662-15169684 AAGCAGCAGGCCCGGCATGGTGG - Intergenic