ID: 1144339942

View in Genome Browser
Species Human (GRCh38)
Location 17:14302597-14302619
Sequence CCTGGTTACCGGAACCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144339934_1144339942 20 Left 1144339934 17:14302554-14302576 CCCGGCGAGGCCGCAGAGTCTGT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG 0: 1
1: 0
2: 1
3: 6
4: 44
1144339936_1144339942 10 Left 1144339936 17:14302564-14302586 CCGCAGAGTCTGTTAACTTTTTG 0: 1
1: 0
2: 3
3: 19
4: 274
Right 1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG 0: 1
1: 0
2: 1
3: 6
4: 44
1144339933_1144339942 29 Left 1144339933 17:14302545-14302567 CCGCGGCGTCCCGGCGAGGCCGC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG 0: 1
1: 0
2: 1
3: 6
4: 44
1144339935_1144339942 19 Left 1144339935 17:14302555-14302577 CCGGCGAGGCCGCAGAGTCTGTT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG 0: 1
1: 0
2: 1
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144339942 Original CRISPR CCTGGTTACCGGAACCCCAA GGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
904586520 1:31583961-31583983 CCGGTTCAGCGGAACCCCAAGGG + Intronic
907963491 1:59306487-59306509 ACTGGTTACCAGAACCCAAAAGG + Intronic
1074108884 10:110408681-110408703 CCTGGTCACCGGAAGCCCTAAGG - Intergenic
1075734387 10:124655000-124655022 CCAGGTTACAGGAGCCCCAGGGG + Intronic
1076323588 10:129602600-129602622 CCTAGTTACCTGAAGCCGAAAGG - Intronic
1081882090 11:46462308-46462330 CCTGGTTTCCCATACCCCAAGGG - Intronic
1084960650 11:72714494-72714516 CCTGGTTCCCCGAAGCCTAAAGG + Intronic
1112078239 13:95936511-95936533 CCTGCCTACAGGTACCCCAACGG + Intronic
1114212294 14:20625698-20625720 CCTGATTGCGGGAACCCAAATGG - Intergenic
1118770738 14:68941004-68941026 CCTGGTGACCGGAACCACCATGG - Intronic
1118907080 14:70031008-70031030 CCTGCTCTCCGGACCCCCAAAGG + Intronic
1121268188 14:92618367-92618389 CCTGGTTAGCCTTACCCCAAGGG + Intronic
1125603347 15:40927360-40927382 CCTGCTTACCTGACCCTCAAGGG - Intergenic
1129197982 15:73982428-73982450 CCTGGAAACCTGAACCTCAATGG + Exonic
1129360225 15:75019809-75019831 CCTGGGTACCTGACCCCCAGGGG + Exonic
1130990039 15:88870741-88870763 CCTGGATCCCAGACCCCCAATGG + Intronic
1138389125 16:56657677-56657699 CCAGGTACCCGGAACCCCAAGGG + Exonic
1139437351 16:66943828-66943850 CATGTCTACAGGAACCCCAATGG + Exonic
1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG + Intronic
1144357253 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG + Intergenic
1149906257 17:60528993-60529015 CCTGGAATCAGGAACCCCAAGGG - Intergenic
1154960936 18:21307869-21307891 ATTGATTACAGGAACCCCAAAGG - Intronic
1159811869 18:73026125-73026147 CCTGGGTAACTGTACCCCAATGG - Intergenic
1161641271 19:5424843-5424865 CCTGGTTCCAGCAACCCCAGTGG - Intergenic
1163028211 19:14526417-14526439 CCTGGTTACCGGAAGCCAGATGG + Intronic
1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG + Intergenic
1164512989 19:28912441-28912463 CCTGCTTCCCAGAACCCTAATGG - Intergenic
1164695442 19:30240416-30240438 TCTGGTCTCCAGAACCCCAAGGG + Intronic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
928260441 2:29761812-29761834 ACTCGTTACTGGAACCCAAAGGG - Intronic
942689746 2:178572877-178572899 CCTTGTTCCTGGAACTCCAAAGG - Exonic
944874030 2:203943730-203943752 CCTGGTTAGCAGAACACAAAGGG - Intronic
1172099454 20:32476414-32476436 CCTGGTTCCCGGAGCCCGCATGG - Intronic
1174745497 20:53057949-53057971 ACTGGTTCCCGGAGCCCAAAAGG - Intronic
1178626842 21:34225523-34225545 CCTGGTAATTGGAACCACAAAGG - Intergenic
1181608964 22:23999938-23999960 CCTGGTTCCCGCAGCCCCCATGG + Intergenic
1182980953 22:34670506-34670528 AGTGGTTACTGGAACCCGAAAGG + Intergenic
950604820 3:14069302-14069324 CCTGGTTAGCTCAACCCTAAAGG + Intronic
961715585 3:128855186-128855208 CCTGGTTACAAGAACCTCTATGG + Intergenic
962669977 3:137695022-137695044 CCTGCTCACAGGACCCCCAAGGG - Intergenic
969214035 4:5708787-5708809 CGAGGTTACCAGGACCCCAAGGG + Intronic
973602803 4:52558622-52558644 CTTTGTTACAGCAACCCCAATGG - Intergenic
982404649 4:155006285-155006307 CCTGCTTACCGGGTCCCCAGAGG - Intergenic
994694430 5:103056709-103056731 CCTGGTTGCTGGAACTCCCAAGG - Intergenic
995556851 5:113338380-113338402 CCTGGCTGTGGGAACCCCAAGGG + Intronic
1005893987 6:30162985-30163007 CAGTGTTACCCGAACCCCAAAGG + Intergenic
1006100081 6:31681194-31681216 CTGGGTTCCTGGAACCCCAAGGG - Intronic
1006810565 6:36817843-36817865 CCTGGTTTCTAGAACCCCAAGGG - Intronic
1059497420 9:114721080-114721102 CCTGGTTTCCAAAACCCCATGGG - Intergenic
1061398009 9:130353955-130353977 CTTGGGTACTGGAACCTCAAAGG + Intronic
1186056446 X:5654579-5654601 ACTGGGTACAGGAACCCAAAAGG - Intergenic