ID: 1144340403

View in Genome Browser
Species Human (GRCh38)
Location 17:14304950-14304972
Sequence GTGGCCTAACCAGTAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 4, 3: 4, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144340403 Original CRISPR GTGGCCTAACCAGTAACCCA GGG Intronic
900208403 1:1441272-1441294 GTGGCCCCACCAGAAACCCAAGG + Exonic
900802309 1:4744995-4745017 GTGGCCTAACCACTGGCCCCAGG - Intronic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
907782927 1:57583623-57583645 GTTGGCAAACCAGTAGCCCATGG + Intronic
917980116 1:180263877-180263899 GTGTCCTAACCAGAGATCCAAGG - Intronic
921139733 1:212295776-212295798 GTTGCCTAAAGACTAACCCACGG - Intronic
923242533 1:232099547-232099569 GTGACCTAATCAGTTTCCCAAGG - Intergenic
924638520 1:245811143-245811165 GTGGCCTTTCCAGTTTCCCAGGG + Intronic
1067014980 10:42751955-42751977 CTGGCCTAACCAGTAGCCCAGGG - Intergenic
1076208306 10:128620888-128620910 GTGACCTCACCATTCACCCAGGG + Intergenic
1076208517 10:128622605-128622627 GTGACCTCACCACTCACCCAGGG + Intergenic
1078456156 11:11477176-11477198 GTGGCCAAACCCAGAACCCATGG + Intronic
1089756908 11:120694015-120694037 GTGGCCCACCTAGTCACCCAAGG - Intronic
1095710167 12:45279626-45279648 GTGTCCTAAACACTGACCCAGGG - Intronic
1096909709 12:54970633-54970655 ATGGCCTATCCGATAACCCATGG - Intronic
1103826515 12:123743352-123743374 GTTGCCAAAGCAGTAACACAAGG + Intronic
1106017127 13:25880094-25880116 GTGCCCAAAACAGTACCCCATGG - Intronic
1106692629 13:32134525-32134547 GTGGGCTAACTAGGAGCCCAGGG + Intronic
1112302051 13:98239680-98239702 GTGGCCCAGCCAGAAACCCAAGG - Intronic
1112912862 13:104509891-104509913 CTCGCCTAACCAGTAGACCATGG + Intergenic
1113067181 13:106384473-106384495 GTGACCTACTCAGTGACCCACGG - Intergenic
1114070427 14:19100759-19100781 CTGGCCTAACCAGTAGCCCAGGG + Intergenic
1114091834 14:19299240-19299262 CTGGCCTAACCAGTAGCCCAGGG - Intergenic
1119586804 14:75843379-75843401 TTGGCCTAACCATTCATCCAAGG + Intronic
1123714164 15:23014234-23014256 GTGGCCTACCCAGTGGCCCTGGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1128333672 15:66772690-66772712 GTTTCCTAACCTGTAACACAGGG - Intronic
1128525942 15:68412360-68412382 GTGGCCTAACGAGCAAATCATGG + Intronic
1133904382 16:10008256-10008278 GTGCCCCAACTAGTACCCCATGG + Intronic
1134097036 16:11424797-11424819 CTGGCCTAGCCAGGACCCCAAGG - Intronic
1141708158 16:85681085-85681107 GTGGGCTTTCCTGTAACCCAAGG + Intronic
1142141806 16:88475949-88475971 GTGGCTGACCCAGTAACCGAGGG - Intronic
1144340403 17:14304950-14304972 GTGGCCTAACCAGTAACCCAGGG + Intronic
1145804071 17:27713972-27713994 GGGGCATAACCAATAGCCCAGGG - Intergenic
1147897008 17:43757631-43757653 CAGGCCTGACCAGGAACCCAGGG + Intronic
1148353473 17:46958064-46958086 GTCACCTCACCCGTAACCCATGG + Intronic
1148579788 17:48735537-48735559 GAGTCCTATCCAGTATCCCAGGG - Intergenic
1152162436 17:78677247-78677269 TTGGCCTACCCAGGAAGCCAAGG - Intronic
1152710390 17:81868260-81868282 GTGGCGAACCCAGTGACCCAGGG - Exonic
1156541026 18:37910666-37910688 CTGGCATAACCAGTTACCCCTGG + Intergenic
1166099207 19:40560985-40561007 GTGGCCTAACCTGTCTGCCAGGG + Intronic
925738669 2:6986154-6986176 GTGGCCTCATCTGTAACCCGAGG - Intronic
929872904 2:45773546-45773568 GTGGCCTAATCATTAGCACAAGG - Intronic
936461200 2:112714824-112714846 GGGACCTAACCAGTACACCAGGG - Intergenic
943403829 2:187454127-187454149 GTGGGCTAACCAGAGACCCAAGG + Intergenic
945133675 2:206602180-206602202 ATGGCCTTATCAATAACCCAAGG + Intronic
948915685 2:241034169-241034191 CTGGCCTAGCCAGTGACACAAGG + Intronic
1169058290 20:2641693-2641715 GTGTCCTAAACTGTATCCCATGG - Exonic
1171020686 20:21581794-21581816 GTGGCATTACCATTAACTCAGGG + Intergenic
1171956203 20:31465698-31465720 GTGGTCTAACGTGTGACCCATGG - Intronic
1171957865 20:31473708-31473730 GTGGTTTAACCTGTGACCCATGG - Intronic
1173940056 20:46903188-46903210 GTGTTCTCACCAGTATCCCATGG + Intronic
1179107834 21:38419190-38419212 ATGGCCTAACCAGTACCCTTTGG + Intronic
1179169228 21:38959858-38959880 GTGGCCCAACCAGACAGCCAGGG + Intergenic
1180488899 22:15823323-15823345 CTGGCCTAACCAGTAGCCCAGGG + Intergenic
1184178218 22:42801855-42801877 GGGGCCTAACCAGGCCCCCAGGG + Intronic
950716082 3:14848533-14848555 GGTGCCTAACCTGTACCCCATGG - Intronic
952382127 3:32813635-32813657 GTGGCCTAACCCCCAACCCAAGG + Intergenic
953209141 3:40858837-40858859 GTGGCATAACCAGGACACCAGGG + Intergenic
953553390 3:43922990-43923012 GAGGCTGAACCAGTGACCCAGGG + Intergenic
954644033 3:52119867-52119889 CTGGCCTTCCCAATAACCCAGGG - Intronic
956519767 3:70091135-70091157 GTGACCTAACACGTGACCCAAGG + Intergenic
965195685 3:165591326-165591348 ATGGCTTAACCAATAACCCCTGG + Intergenic
968494173 4:906424-906446 CTGGCCCAACCAGGAAACCAGGG + Intronic
972941932 4:44206534-44206556 GTTGTCTATCCAGTGACCCAAGG + Intronic
987385824 5:17328430-17328452 GTGTTCTAACCAGCAACCCCAGG - Intergenic
992089816 5:73306965-73306987 GTTGCCTAACAGGAAACCCATGG + Intergenic
999885658 5:155920149-155920171 GTGTCCCAACCAGGAAGCCAGGG - Intronic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1000796659 5:165672491-165672513 CTGGCCTAACCAGTACCCGTTGG + Intergenic
1002666170 5:180827058-180827080 GTGGCCTAACTAGAAGACCAAGG - Intergenic
1023106515 7:36768193-36768215 GTGACCTATGCAGTCACCCAGGG - Intergenic
1030745886 7:113166002-113166024 GAGACCTAAAGAGTAACCCAGGG + Intergenic
1046476411 8:114750237-114750259 CTGGCCCAACCCGTAGCCCAGGG - Intergenic
1051381246 9:16460904-16460926 GTGGCCTTAGCATAAACCCAAGG + Intronic
1053229928 9:36400235-36400257 GCAGCCTATCCAGAAACCCACGG + Intronic
1055582023 9:77715844-77715866 GTGTGCTACCCAGTAAACCAGGG + Intergenic
1186389462 X:9144208-9144230 ATGGAGTAACCAGTAGCCCATGG + Intronic
1188751644 X:33912217-33912239 GTGGCTTTACCAGTAGTCCATGG - Intergenic