ID: 1144346778

View in Genome Browser
Species Human (GRCh38)
Location 17:14356545-14356567
Sequence TAGGGGGTAAGGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144346770_1144346778 2 Left 1144346770 17:14356520-14356542 CCATATAGAGCAAACTGAAGGAA No data
Right 1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144346778 Original CRISPR TAGGGGGTAAGGAGGCAGGA AGG Intergenic
No off target data available for this crispr