ID: 1144350278 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:14388595-14388617 |
| Sequence | AGGTGGGGATAGAAGGAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144350271_1144350278 | 20 | Left | 1144350271 | 17:14388552-14388574 | CCTTATATAATCAAGGCATGGGA | No data | ||
| Right | 1144350278 | 17:14388595-14388617 | AGGTGGGGATAGAAGGAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144350278 | Original CRISPR | AGGTGGGGATAGAAGGAAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||