ID: 1144350278

View in Genome Browser
Species Human (GRCh38)
Location 17:14388595-14388617
Sequence AGGTGGGGATAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144350271_1144350278 20 Left 1144350271 17:14388552-14388574 CCTTATATAATCAAGGCATGGGA No data
Right 1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144350278 Original CRISPR AGGTGGGGATAGAAGGAAGA GGG Intergenic
No off target data available for this crispr